You're about to create your best presentation ever

Biochem Presentation Background

Create your presentation by reusing one of our great community templates.

Biochem Presentation

Transcript: Hayley Kim and Jamie Woych Treatment of HIV/AIDS by Inhibition of HIV-1 RT What is HIV? What is HIV 1-Reverse Transcriptase? Specific Antiretroviral Drugs Broad Spectrum Antiretroviral Drugs Current and Future research Overview Overview Human Immunodeficiency Virus, or HIV, attacks the body’s immune system, specifically the CD4 cells (T cells). HIV results in a higher susceptibility to attack on the immune system by disease and cancer This virus also leads to AIDS, a debilitating and deadly disease of the human immune system. HIV/AIDS is affecting over 1.2 million people in America What is HIV? HIV HIV-1 RT HIV-1 Reverse Transcriptase is an enzyme encoded for within the Human Immunodeficiency Virus (HIV) genome Function is transcribing double stranded DNA from the ss viral RNA template. HIV-1 RT is currently being studied as a target for HIV treatment HIV-1 RT also transcribes mistakes every 1 in 2000 base pairs HIV 1-RT HIV-1 RT has two active sites: polymerase active site, and RNase H active site. The polymerase active site acts in the polymerization of DNA strands The RNase H active site works to cleave RNA strands from RNA/DNA hybrids created during the replication process. Active Sites of HIV-1 Reverse Trascriptase Specific Antiretroviral Drugs Specific Drugs Antiretroviral drugs are subdivided into two categories: nucleoside reverse transcriptase inhibitors (NRTIs) and non-nucleoside reverse transcriptase inhibitor (NNRTIs) NRTIs Nucleoside reverse transriptase inhibitors (NRTIs) NRTIs are inhibitors that terminate the polymerization of the viral DNA strand. They can act as substrates that competitively inhibit the replication process. NRTIs have structural similarity to nucleosides, and can imitate a dNTP during the replication process and stop elongation. Azidothymidine (AZT) is a NRTI drugs that utilizes their structural similarity with thymine to halt DNA replication Thymidine analogues such as azidothymidine (AZT Structural Similarity NNRTIs NNRTIs have varying chemical structures, and act as noncompetitive inhibitors to the replication process. NNRTIs bind more specifically, targeting hydrophobic pockets that are close in proximity to the polymerase active site This higher specificity can suppress HIV replication even at lower concentrations Nevirapine is an NNRTI used that allosterically binds to this pocket and incites a conformational change in the enzyme, blocking the binding of the RNA template strand. Non-nucleoside reverse transcriptase inhibitor (NNRTIs) Nevirapine is an NNRTI used that allosterically binds to the hydrophobic pocket. The binding of NNRTIs Highly active antiretroviral therapy The use of a combination of NRTIs and NNRTIs has proven to be much more effective for the repression of viral replication. Highly active antiretroviral therapy or (HAART) is the use of multiple drugs with more than one target site for peak efficiency of treatment. Different sets of drugs are delivered to the patient in a rotating fashion to combat drug resistant strains Yet it still caused a drastic increase in multiple drug resistant strains of HIV This is due to its heightened ability for mutation These NRTI and NNRTI resistant mutations have created a demand for alternative antiretroviral drug treatments Highly active antiretroviral therapy Broad Drugs Broad Spectrum Drugs decrease in specificity of drug binding allows for a broader range of target domains, with limited resistance Broad spectrum drugs are able to inhibit many variants of the viral structure KM-1 Highly efficient on a wide range of enzyme conformations KM-1 inhibits replication similarly to NNRTIs by lowering HIV-1 RT’s affinity for the dNTP substrates This compound does not bind the hydrophobic pocket but rather inhibits RT by lowering the affinity of the enzyme toward the nucleic acid substrate KM-1 NAPETA N-{2-[4-(aminosulfonyl)phenyl]ethyl}-2-(2-thienyl)acetamide (NAPETA) Low specificity of binding results in a lower risk of resistance to the drug. The functions of NAPETA include: interfering with the formation of the Reverse Trascriptase DNA complex. decreases enzyme affinity, and acts as a DNA Polymerase inhibitor, wholly repressing polymerase activity of the virus. NAPETA Current Research These drugs target both HIV-1 RT and Integrase (IN) enzymes in the virion, and are engineered by rational design based on the targets. Integrase (IN) enables the viral genetic material to be integrated into the DNA of the infected cell. Current research has focused on the individual enzyme targets, but future shifts will focus on studying the maturation process of the enzymes The folding patterns of HIV-1 RT is presently known, and through rational design, inhibition of this pathway may be targeted to prevent these enzymes from assuming structurally functional forms. Current Research Dual Inhibitory Drugs Conclusion What is HIV? What is HIV 1-Reverse Transcriptase? Specific & Broad Spectrum Antiretroviral Drugs Future research possibilities

Biochem Presentation

Transcript: B-actin B-tublin Glyceraldehyde-3-phosphate dehydrogenase (i) B-tubulin: forward primer 5'-CTGTTCGCTCAGGTCCTTTTG-3' and reverse primer 3'-CCTCCTTCCGTACCACATCCA-5' (ii) B-actin: forward primer 5'AGGCATCCTCACCCTGAAGT-3' and reverse primer 3'-AGGGATAGCACAGCCTGGAT-5' (iii) GAPDH: forward primer 5'-CATGAGAAGTATGACAACAGCCT-3' and reverse primer 3'-AGTCCTTCCACGATACCAAAGT-5' Extracted total RNA from different leukocytes using RNeasy kit. Dissolved RNA pellets in DEPC- treated water and stored at -20°C until needed 200 ng RNA mixed with 1μl dNTP and 5μl oligo dT for 5 minutes at 65°C Mixed with 4μl of 5X buffer, 2μl 0.1 M DTT (dithiothreitol), and 1μl of RNaseOUT = total volume of 20μl before reverse transcription (RT) for 60 minutes at 42°C using reverse transcriptase Lower b-actin expression in CBMCs was due mainly to monocytes Conclusion Products were subjected to PCR amplification using specific primers and SYBR Green quantification to amplify three different transcripts as follows Activated by heating for 10 minutes at 95°C, then 60 seconds at 60°C, and for 15 seconds at 95°C for 40 cycles in PCR mix containing 2μl of cDNA template, 1X quantitative PCR mastermix 100 nM of each primer, 1μl of SYBR Green = total volume of 30μl. All reactions performed in an ABI PRISM 7500 Sequence Detection System Only GAPDH was expressed at a consistently stable level B-actin was expressed at much lower levels in MNCs from children less than 3 years old B-tubulin exhibited large individual differences across the age groups Glyceraldehyde-3-phosphate dehydrogenase is a reliable internal control in Western blot analysis of leukocyte subpopulations from children Expression of b-actin protein in MNCs was age dependent Compared expression levels of b-actin, b-tubulin, and GADPH in both PBMCs and CBMCs Found that only GADPH was expressed at equal amounts in both Serial dilution to determine if GAPDH remained constant Both cell types incubated with anti-GAPDH exhibited similar signal intensities, which were gradually increased ββ Collected in heparinized tubes (10 U/ml) by cordocentesis PMBCs (peripheral blood mononuclear cells & CMBCs (umbilical cord blood mononuclear cells) isolated by 4.5% dextran sedimentation Blood mixed at a 5:1 ratio of 4.5% (w/v) dextran in 10-ml tubes and stood upright undisturbed at room temperature for 30 minutes Gently layered leukocyte supernatant on top of Ficoll-Paque at a 2:1 ratio Introduction Cell Culture & Treatment Housekeeping genes of B-actin and b-tubulin exhibited consistent levels of mRNA expression in different leukocytes populations from new borns and adults mRNA's, not proteins encoded by housekeeping genes consistently expressed Post translational regulation responsible for low B-actin Neither B-actin nor B-tubulin was a reliable control GAPDH was a reliable control for protein assessment of samples for subjects of all ages GADPH was a more reliable internal loading control than b-actin and b-tubulin in Western blot analysis Leukocytes lysed in cold radioimmunoprecipitation assay (RIPA) lysis buffer containing protease inhibitors. Protein concentration determined using protein assay kit Aliquots of crude extracts (containing 10 μg protein) used in Western blot analysis. CD3-, CD14-, and CD19-positive T cells, monocytes, and B cells isolated from adult PBMCs and CBMCs using isolation kits Positive magnetic sorting using autoMACS Separator. Purified using flow cytometry Western Blotting •Hong-Ren Yu, Ho-Chang Kuo, Hsin-Chun Huang, Li-Tung Huang, You-Lin Tain, Chih-Cheng Chen, Chi-Di Liang, Jiunn-Ming Sheen, I-Chun Lin, Chi-Chiang Wu, Chia-Yu Ou, Kuender D. Yang. Glyceraldehyde-3-phosphate dehydrogenase is a reliable internal control in Western blot analysis of leukocyte subpopulations from children. Analytical Biochemistry. Volume 413, Issue 1, Pg 24-29. 1 June 2011. RT-PCR Aliquots of monocytes in RPMI-1640 medium containing 10% heat-inactivated fetal bovine serum were treated with actinomycin D, cycloheximide, or MG132, each prepared in a stock solution made in water or (DMSO) Cells harvested by centrifugation for total RNA or protein collection Western Blotting Housekeeping Proteins B-Actin B-Tubulin GAPDH Monocyte Neonate Centrifuged at 1500 rpm for 30 minutes to separate PMNs from MNCs Collect MNCs by pipetting cells directly from interface Transferred cells to new tube, washed, and suspended with phosphate-buffered saline Membrane blots blocked using TBST containing 5% nonfat dry milk before exposing to the primary antibodies Horseradish peroxidase-conjugated secondary antibodies for 2 hours Developed membranes using ECL Plus Kit and Kodak X-ray film exposure. Densitometric intensity measured and analyzed using an LAS-3000 and Multi Gauge version 3.0 Posttranslational regulation was responsible for low b-actin expression in neonatal monocytes Collection & Preparation Collection Materials & Methods Measured b-actin mRNA level and protein level in cord and adult blood monocytes Expression

Biochem Presentation

Transcript: Future Research E. D. Steinberg et al. , 1998 A2780 (ECACC 93112519) Wavelengths tested don't penetrate far into tissue: Toxicity of Tetraplatinated Poryphrins in Cell Culture Platinum Based Pharmaceuticals Domcke, Silvia et al. "Evaluating Cell Lines As Tumour Models By Comparison Of Genomic Profiles". Nature Communications 4 (2013). Harvested from untreated patient Cisplatin Sensitive Ovarian Carcinoma Cells Viscosity Testing Produce extracellular structural proteins (eg collagen, elastic fibers HeLa Cells Paul Goodland, Kim Fields, and Peter Zhang, n. d. Naik et al. 2014 Control Porphyrins Cisplatin Resistant Ovarian Carcinoma Cells Conjugated, aromatic heterocycles Naturally occurring- heme, chlorophyll, cytochromes, vitamin B12 Four nitrogen in middle can coordinate to metals Absorb light > electron promoted > upon return to ground state, energy transferred to molecular oxygen, producing singlet oxygen Photocleavage Oldest human cell line Kelland, Lloyd. "The Resurgence Of Platinum-Based Cancer Chemotherapy". Nature Reviews Cancer 7.8 (2007): 573-584. Localization Guanosine Binding ROS can damage nucleic acids, and oxidize fats, proteins, and cofactors Photosensitizer activated by light Generates ROS, induce cell death Can precisely control when, where activated Promising cancer treatment Merged Combine photodynamic therapy and platinum Kelland, 2007 These compounds localized to the nucleus Characterization DIC Anu Naik, Riccardo Rubbiani, Gilles Gasser, and Bernhard Spingler http://www.phe-culturecollections.org.uk Normal human fetal lung cell line used Naik et al. 2014 Naik et al. 2014 2 Conclusions A2780cis (ECACC 93112517) EtBr Competition Assay DNA Binding ISTOCKPHOTO/THINKSTOCK Immortal Play role in tumor inflammation response via ECM remodeling Cell Culture Nedime Serakinci, Rikke Christensen and Umut Fahrioglu, 2011 Nedime Serakinci, Rikke Christensen, and Umut Fahrioglu. Transformation Of Mesenchymal Stem Cells. 1st ed. INTECH Open Access Publisher, 2011. Convert large molecules to gaseous ionic state for mass spec For all compounds tested, high concentration needed to kill cells in dark; low concentration needed to kill cells with light exposure 3 Cervical cancer Dolmans, Fukumura and Jain, 2003 Research Approach Dolmans, Dennis E.J.G.J., Dai Fukumura, and Rakesh K. Jain. "TIMELINE: Photodynamic Therapy For Cancer". Nature Reviews Cancer 3.5 (2003): 380-387. IR HNMR PtNMR ESI-MS Elemental analysis UV/Vis spectroscopy Same as in previous slide, but resistant to cisplatin Human Fibroblasts They bind to guanosine in DNA and DNA is damaged upon exposure to 420 nm light Mitotracker The tetraplatinated compounds synthesized were toxic cancer to cells upon exposure to light http://www.phe-culturecollections.org.uk References Angelo Frei, Wikimedia Common, 2013 Potentially not suitable as ovarian cancer model (Domcke et. al, 2013), probably fine for this research Provides ability to control temporal, spatial activation of drug + action of Pt based compounds Sternberg, Ethan D, David Dolphin, and Christian Brückner. "Porphyrin-Based Photosensitizers For Use In Photodynamic Therapy". Tetrahedron 54.17 (1998): 4151-4202. Naik et al. 2014 Visible-Light-Induced Annihilation of Tumor Cells with Platinum– Porphyrin Conjugates DAPI Elucidate mechanism of DNA cleavage Determine if results similar in vivo Determine if compounds always intercalate with DNA, or only upon light exposure- potential issues if intercalates in dark Mixed cell culture, determine if differential localization based on cell type 4 Naik et al. 2014 Photodynamic Therapy HeLa cells Human fibroblasts Cisplatin sensitive ovarian carcinoma cells Cisplatin resistant cells ovarian carcinoma cells Poryphrin Synthesis Compound Binding of compound 4 results in the formation of new downfield shifted peaks UV/Vis Absorbance Changes with addition of DNA to Compound 4 Naik, Anu et al. "Visible-Light-Induced Annihilation Of Tumor Cells With Platinum-Porphyrin Conjugates". Angewandte Chemie 126.27 (2014): 7058-7061. 1 https://www.atcc.org/products/all/CCL-171.aspx#characteristics

Biochem Final Presentation

Transcript: Octreotide Commonly used in research Not specific to NETs High activity and NET specificity Inactive in normal tissues Less research on use of promoter Breast Cancer 8,9,10 24 2,3 VS. Our Final Drug OATin Drug Administration Outside the cell AAVP Annexin V Figure 4: Comparison of (A) planar OctreoScan (B) fused OctreoScan/SPECT/CT (C) planar Ga-DOTATOC PET and (D) Ga-DOTATOC PET/CT in the same patient (19) Eukaryotic adeno-associated virus + prokaryotic bacteriophage Expression of octreotide on pIII coat protein of bacteriophage for specific targeting of NETs OATin Team Glycine NET Diagnosis Somatostatin Receptor 2 SOLUTION Customization GRP78-binding motif TRAIL SSTRs are a family of GPCRs that inhibit secretions and have anti-proliferative effects SSTRs are expressed in both normal and malignant cells SSTR2s are the most widely studied subtype and is the most frequently expressed subtype in human tumours Neuroendocrine tumours INSM1 TRAIL NET TRAIL AAVP INSM1 Cytoplasm 21 Gallium PET Octreotide 19,20 (6) Mechanism of Drug Action: Part II OATin: The Movie Pro- INSM1 6,7 OATin AAVP CMV 68 Lekky, Danny, Khash, Shawn, Hannah, Sharon, Laura, Jason AAVP Mechanism of Drug Action: Part I CMV References 5 1,11,12,13 INSM1 WELCOME CGCCCGCGTCTCGCCTCTTTCTCCCCGAAGAGAG 1 GFP 22,23 SST Analogues: Octreotide Neuroendocrine cells receive neuronal input and release messages (hormones) to the blood Generally indolent in nature, but can also be quite difficult to treat Figure 2: hTRAIL Type I and Type II pathway Figure 5: Annexin V Assay (22) TNF-related apoptosis-inducing ligand Death-inducing member of the tumour necrosis factor (TNF) superfamily Human TRAIL binds to 5 receptors Only TRAIL-RI and R2 contain a death domain capable of inducing cell death 2 pathways initiate apoptosis in mammals Extrinsic (type I) and intrinsic (type II) pathways 1 TRAIL Neuroendocrine Tumours Figure 3: Structure of the hybrid vector AAV/phage (AAVP) (14) 68 Higher affinity to SSTR2 than SST Endocytosed through receptor internalization TRAIL AAVP 15,16,17,18 Cytoplasm Our Sequence: Promoter 15,16,17,18 Octreotide Octreotide INSM1 AAVP TRAIL

Biochem-Infertility Presentation

Transcript: Results Coiled shape Fructose Normal shape Correlation 7.46 ± 7.92 unrelated to fructose levels fructose doesn't contribute to infertility due to its effect on semen parameters testosterone levels appear to correlate positively with ASA levels highest levels of testosterone were exhibited by men with varicocele ASA tends to reduce viscosity of semen 13.71 ± 10.53 unrelated to fructose levels unrelated to fructose levels 17.63 ± 12.84 50.48 ± 19.36 Contributing factors to varicocele-related infertility? Weak motility 490 nm Slightly abnormal shape 367.5 ± 21.8 3.05 ± 7.50 Testosterone 6.91 ± 6.58 19.20 ± 17.96 12.76 ± 11.17 ASA 7.88 ± 10.41 365.9 ± 16.55 21.35 ± 11.09 Dahistani, H.I.; Hamad, A.R.; Abdel-Dayem, M.; Al-Swaifi, M.; Abu Zaid, M. unrelated to fructose levels 5.26 ± 13.28 Active Motility Viability direct to varicocele; related to ASA levels 44.56 ± 23.55 Hormones unrelated to fructose levels Fertile Varicocele Evaluation of Serum Testosterone, Progesterone, Seminal Antisperm Antibody, and Fructose Levels among Jordanian Males with a History of Infertility 8.12 ± 8.75 380.74 ± 24.331 40.26 ± 28.29 agglutination: clumping of red blood cells in the presence of an antibody sRBCs + sperm indicates IgG on sperm unrelated to varicocele; related to viscosity incubated with alkaline phosphatase-labeled reagent label quantified using a specific chemoluminescent substrate light emission detected by a photomultiplier tube unrelated to fructose levels ASA as % of Males Studied No Varicocele 8.82 ± 12.67 8.52 ± 14.09 Parameter 32% 16.48 ± 12.09 26% 7.93 ± 7.65 IgG 24%

Now you can make any subject more engaging and memorable