Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Una porta obrinse "yneeeeeeeeeec

No description
by

Irene Rubinat

on 13 December 2013

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Una porta obrinse "yneeeeeeeeeec

fenòmens sonors i les seves
onomatopeies
design by Dóri Sirály for Prezi
Start
CASA
Step 1
Arreglant un pont amb un taladro " rrrrrrrrrrrrrrrrrrrrrrrr"
Step 2
cotxe a la carretera "brombrombrombrombrom"
Step 3
El vent contra els arbres "sfxsfxsfxsfxsfxsfx"
Una porta obrint-se " yneeeeeeeeeeec
Les ales d'un helicòpter "tbutbutbotbotbotbo"
nens jugant per casa "jajajajajajajajajaja"
Un gos bordant " guauguauguauguauguau
la mare aspirant la casa "znznznznznznznznznznz"
un plat trencant-se "plassssssssssssssssssssssssssssss"
un ocell cantant " piupiupiupiupiupiupiu

gràcies per la vostra atenció
Irene Rubinat Mir
Full transcript