Loading presentation...

Present Remotely

Send the link below via email or IM


Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.


Levaduras frente a Penicillium

Selección de levaduras epífitas con actividad antagonista frente a Penicillium expansum en poscosecha de manzana

Luciana Zuñiga

on 21 August 2012

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Levaduras frente a Penicillium




Incubación 1 semana a 20 °C

Desarrollo de posible actividad patogénica de lesiones Poscosecha
Daños producidos por hongos:

Pudrición azul
( Link) 20 µL
(1x10 células mL ) 20 µ L
(1x10 conidias mL ) levadura

Número de heridas con pudrición x 100
Número total de heridas

DLA x 100

DLA es X del diámetro de la lesión en las heridas con antagonistas
DLC: es X del diámetro de la lesión en las heridas inoculadas en el tratamiento control Penicillium expansum UNIVERSIDAD DE CONCEPCIÓN
(13,2 % superficie
frutal Chile). Principales cultivares exportados:

Royal Gala

Granny Smith

Richard Delicious

Fuji http://fmconsultoria.blogspot.com 636 mil toneladas http://www.chileanfreshfruit.com (ODEPA, 2012) (ODEPA, 2012) Principales mercados de destino (Centro de Pomáceas Universidad de Talca, 2010; FAO, 2010) Moho Azul ages.at Control de P. expansum Fungicidas sintéticos
Restricción mercados Alternativas de control

Control Biológico
(Spadaro y Gullino, 2004; Mondino y Vero, 2006) Levaduras Actividad antagonista frente a
(Vero ., 2002) P. expansum et al Objetivo Seleccionar e identificar levaduras epífitas aisladas desde frutos de vid y manzano con actividad antagonista e frente al patógeno
en poscosecha de manzana. P. MATERIALES Y MÉTODOS Sustrato, patógeno y antagonistas 'Fuji', calibre 100
Sistema orgánico
Almacenadas entre 0 y 1°C
Cultivo monospórico
Suspensión de 1x10 conidias mL Penicillium expansum 4 -1 Aislados superficie de uva y manzana
Suspensión de 1x10 células mL Por LUCIANA ALEJANDRA ZÚÑIGA MANCILLA Incubación a 20 °C por 14 días
Medición de halo de inhibición
del micelio del patógeno Agar Extracto de Malta
(AEM) Determinación de actividad patogénica de las levaduras seleccionadas in vivo Selección de levaduras con actividad antagonista
sobre in vivo



Incubación 7 días a 20 °C

Incidencia y Severidad 20 µ L
(1x10 células mL ) levadura 8 -1 P. expansum 24 horas P. expansum 4 -1 Efecto inhibitorio de las levaduras seleccionadas sobre la germinación de conidias de
(1x10 - 1x10 - 1x10 -1x10 - 1x10 - 1x10 células mL ) 100 µ L levadura 5 -1 P. expansum
(1x10 conidias mL ) P. expansum 4 -1 ó 100 µL Agua destilada (control) 800 µ L de medio Caldo Extracto de Malta (Difco ) 6 7 8 9 10 100 µ L Incubación hasta que control alcanzó un 90 % de germinación bajo dos regímenes térmicos 0 y 25 °C (3 repeticiones) Se consideró una conidia germinada cuando : el largo del tubo germinativo 2 n n = diámetro conidia Se determinó la concentración efectiva (CE) de inhibición de germinación de esporas en un 50 % (CE ) y 90 % (CE ) Identificación de las cepas de levadura seleccionadas Extracción de ADN Mini kit DNeasy Plant (Qiagen, Alemania) PCR Digestión HaeIII, HinfI, HhaI (Biolabs, Reino Unido) 35 ciclos 94 °C → 60 s.

55,5 °C → 30 s.

72 °C → 60 s Macrogen (Korea)
GenBank (Blast) (Esteve-Zarzoso .,1999) 1 2 3 4 5 6 9 10 11 12 Evaluación de la actividad antagonista de las levaduras seleccionadas a 0 °C in vivo 8 -1 24 horas P. expansum 4 -1 13 Las levaduras que redujeron la severidad del patógeno sobre un 50 % fueron seleccionadas para los siguientes bioensayos Se seleccionó la levadura que presentó la mayor actividad antagonista frente al patógeno Efecto de la concentración de la levadura yak1.3 en la supresión de la pudrición azul en frutos a 0 °C ó 20 µ L Agua destilada (control) 24 horas P. expansum 14 Tratamientos
(3 repeticiones) Diseño experimental y análisis de datos
Completamente al azar

Análisis de varianza (95%)

Comparación de medias: test DMS (95%)

Supuestos ANDEVA:

Concentración efectiva de inhibición de germinación de esporas en un 50 % (CE ) y 90 % (CE ): 15 Shapiro-Wilk modificado (normalidad)
Bartlett (homogeneidad)
Software InfoStat versión 2008 Análisis Probit usando el programa Polo Plus V 2.0 RESULTADOS Y DISCUSIÓN Identificación de las cepas de levadura seleccionadas 16 17 18 19 Evaluación de la actividad antagonista de las levaduras seleccionadas a 0 °C in vivo 20 Efecto de la concentración de la levadura yak1.3 en la supresión de la pudrición azul en frutos 21 n = 260 aislados 40 aislados seleccionados et al Figura 2. Incidencia y severidad de la pudrición azul en manzanas inoculadas con levaduras epífitas. REGIÓN ITS1 ITS4 ADN ribosomal ITS1 (5’ TCCGTAGGTGAACCTGCGG 3’)
ITS4 (5’ TCCTCCGCTTATTGATATGC 3’), 26 PREPARACIÓN SUSPENSIÓN PATÓGENO. Incubar 7-14 días a 20 °C en Medio Agar Papa Dextrosa Contabilizar las concentración de conidas en una cámara de Neubauer.
Obtener suspensión con 10 conidias mL . 24 aislado aislado aislado
100bp yak1.3 1 2 3 rg4.26 1 2 3 m11 1 2 3 50 bp 1 = HaeIII
2 = HinfI
3 = HhaI. 27 49 g Czapeck + 3 g Extracto de levadura PREPARACIÓN SUSPENSIÓN ANTAGONISTA. Cultivadas en Caldo Levadura Peptona Dextrosa.
Incubadas 25 °C en agitación constante a 140 rpm por 72 horas. Centrifugadas a 4000 rpm durante 10 minutos y lavadas con agua destilada estéril Contabilizar las concentración de células.
Obtener suspensión deseada 25 CULTIVO MONOSPÓRICO. 10 mL Agua destilada Solución Madre 9 mL Agua destilada 1 mL solución madre 1 mL 1 mL 1 mL Obtener 10 conidias mL y sembrar 100 µL de la suspensión en placas de Petri con medio Agar Papa Dextrosa. 50 90 50 90 Pudriciones blandas,
moho blanco azulado Patulina Micotóxina % Incidencia = % Severidad = Primer ITS1 y primer ITS4 región ITS-5.8S 95° C → 7 min. 72 °C → 10 min. Selección de levaduras con actividad inhibitoria
sobre en dos medios de cultivo in P. expansum vitro Selección de levaduras con actividad antagonista
sobre in vivo P. expansum Efecto inhibitorio de las levaduras seleccionadas sobre la germinación de conidias de P. expansum P. expansum I: 52,1 %
S: 42,3 % I: 52 %
1. Levaduras epífitas de manzana y uva presentan actividad antagonista sobre

2. Tres aislados de levadura permitieron disminuir la severidad de la pudrición azul a 0 y 20 °C, los que fueron identificados como
(aislados yak1.3 y m11) y (aislado rg4.26)

3. La levadura presentó la mayor actividad de biocontrol sobre la pudrición azul en manzana a 0 °C durante 42 días de almacenaje Penicillium expansum Pichia guilliermondii Hanseniaspora uvarum P. guilliermondii Penetra al Fruto Heridas:
Lenticelas Actualmente Meyerozyma guilliermondii (Tepper y Yoder, 1982; Schinca .,2011) et al Superficie total por región al 2011 (ha) Selección de levaduras con actividad inhibitoria
sobre en dos medios de cultivo 10 L
(1x10 conidias mL ) in P. expansum 4 vitro Agar Czapeck Levadura

0 = sin signos visibles de inhibición de , el micelio
sobrepasó la colonia del antagonista

1 = ambos organismos detuvieron su crecimiento al entrar en contacto

2 = la zona de inhibición entre patógeno y antagonista es < 2 mm de
ancho P. expansum 4 aislados de Levadura 7 8 3 = la zona de inhibición es entre 2 y 4 mm

4 = la zona de inhibición es > 4 mm SELECCIÓN DE LEVADURAS EPÍFITAS CON
(1x10 células mL ) -1 levadura ó 20 µL Agua destilada (control) 8 µ ó 20 µ L Agua destilada (control) 20 µ L
(1x10 conidias mL ) µ µ µ µ µ µ ® µ µ ó 20 µL Agua destilada (control) µ µ µ


Incubación 21 ó 42 días entre 0 y 1 °C
+ 7 días 20 °C

Incidencia y Severidad Tratamientos
(3 repeticiones) 20 µ L levadura
(1x10 - 1x10 - 1x10 -1x10 células mL ) µ µ 20 µ L
(1x10 conidias mL ) µ ≥ Figura 1. Inhibición del crecimiento miceliar de por aislados de levaduras epífitas en dos medios de cultivo. 8 -1 ® Identificación molecular de los aislados yak1.3, rg4.26 y m11 en base a fragmentos de restricción de la región ITS-5.8S. Número de aislados
de levaduras Número de aislados
de levaduras 40,9 % 46,9 % 48,5 % Pudrición azul (%) 2 52 % Pudrición azul (%) Pudrición azul
(%) Pudrición azul
(%) 1 1


Incubación 21 días entre 0 y 1 °C
+ 7 días 20 °C

Incidencia y Severidad (células mL ) -1 (células mL ) -1 Sánchez ., 2008. et al Coelho ., 2007 et al Filonow ., 1996 et al Droby ., 1992 et al Gel agarosa 3 cm -1 10 9 -1 8 7 4 -1 Aislados provenientes de uva Aislados provenientes de manzana 2 -1 4 -1 10 10 10 9 10 8 Control (Células mL ) -1 expansum in vitro in vivo Grado de inhibición por escala propuesta por Swadling y Jeffries (1996): °
Full transcript