Loading presentation...

Present Remotely

Send the link below via email or IM


Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.


Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Copy of Biology: DNA

Explains the structure of DNA and the relationship of DNA and chromosomes.

Kate Hendrickson

on 3 April 2014

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Copy of Biology: DNA

How was DNA discovered?
Deoxyribonucleic Acid
DNA was discovered almost by accident.
In 1928 Frederick Griffith was trying to determine
how bacteria make people sick:
Griffith isolated two strains of
streptococcus pneumoniae from mice. One strain caused the disease pneumonia and one was harmless.
The disease causing strain grew smooth cultures on the agar plate. The non-disease causing strain grows with rough edges. The difference in appearance made it easy to distinguish the type of bacteria.
Here is how his experiment worked:

1. When he injected the mice with the disease causing strain the mice died of pneumonia.

2. When he injected the mice with the non-disease causing strain the mice did not get sick.
3. When he killed the disease causing bacteria with heat and then injected the dead bacteria into the mice. The mice did not get sick.

4. BUT--when he injected the mice with a mixture of both the harmless bacteria and the strain that had been killed by heat--THE MICE DIED!
When Griffith examined the lungs of the mice he found a population of the bacteria that caused the disease alive and thriving. Somehow the heat-killed bacteria had passed the disease causing ability to the harmless strain of bactera. He called the process--transformation.
Griffith hypothesized that when the live harmless bacteria is mixed with the heat-killed bacteria, some factor was transferred from the heat-killed cells into the live bacteria. He thought the transforming factor might be a gene.
Griffith's Experiment
How was DNA discovered?
Avery's Experiment
In 1944 Oswald Avery repeated Griffith's experiment. His goal was to isolate the tranforming factor.
He and his team did the following experiment:
1. They killed the S-strain of the streptoccocous bacteria with heat and blended it up to break the cells apart.

2. They added enzymes that destroyed each of the different types of molecules in the bacteria soup. These molecules included proteins, carbohydrates, lipids, RNA and DNA.
3. Then they added the soup mix to a broth containing R-strain bacteria.

4. After a bit they examined the new cultures and found these results:
- Lipase--both S and R strains
-Protease--both S and R strains
-Carbo-ase--both S and R strains
-RNase--both S and R strains
-DNase--only the R strain.
From this experiment Avery concluded
DNA was the transformative agent.
How was DNA discovered?
Hershey and Chase's experiment
Alfred Hershey and Martha Chase wanted more evidence that DNA was indeed the transformative factor. So they created their famous experiment in 1952.
It was not always understood that DNA was the molecule that carried the genetic information in all organisms. Most people thought it was a protein. Three key experiments opened the door to our understanding of DNA and began the field of molecular biology.
Before you can understand their experiment you must understand the basic structure of a virus. The diagram to the left is a bacteriophage. Bacteriophages are viruses that kill bacteria. They are made of only two things: Proteins and DNA.
Once the bacteriophage attaches to a bacteria it injects its DNA into the cell. The DNA is taken up by the DNA of the bacteria and used to make proteins, but the proteins that are made are the parts of the virus. The parts are put together (as per instruction by the DNA) and the cell fills with viruses. Once it gets too full it ruptures or lyses and the viruses are released to infect other bacteria.
Hershey and Chase did the following experiment:
1. They grew two cultures of viruses. To the first they added Phosphorus 32 which is radioactive. To the second they added Sulfur 35 which is also radioactive. They used radioactive isotopes because they are easier to track.

2. They used phosphorus because DNA has lots of it and Proteins have none. They used sulfur because proteins have lots of it and DNA has none.

3. They added the viruses to the bacteria so they would be infected and begin replicating.
4. They blended up the bacteria which seperated the phages (viruses) outside the cells from the bacteria.

5. They put the mix in a centrifuge this caused the viruses and the bacteria to seperate into two groups.

6. They tested the groups to see if what element was present the most.
The results:
The part of the solution on top is called the supernatent it is the liquid part of the solution. The part on the bottom is called the pellet and this is the part that would be made of the cells. We would expect to find the genetic component in this part of the solution. When Hershey and Chase examined the solution they found almost all of the phosphorus in the pellet and almost all of the sulfur in the supernatent. This suggests DNA is what was put into the cell and what transferred the genetic information.
What is DNA?
DNA is a very large molecule that does three things for an organism.
The three jobs DNA does in for an organism:
1. DNA has to carry information from one generation of organism to the next.
2. DNA has to put that information to work by determining the heritable characteristics of organisms.
3. DNA has to be easily copied because all of a cell's genetic information has to be replicated every time a cell divides.
DNA is a long molecule that is made of nucleotides strung together. There are three parts to a nucleotide:
The three components of a nucleotide include:
1. A 5-carbon sugar called deoxyribose.
2. A phosphate group.
3. A nitrogenous base. There are four kinds of bases:

Once it had been established that DNA was indeed the molecule that carried the genetic information, the focus became the molecule's structure. The structure was not discovered by one person, it took the work of 5 scientists to finally break the code.
How was the structure of
DNA determined?
Chargaff's Observations
Erwin Chargaff was looking at the ratios of adenine, thymine, cytosine, and guanine. He noticed something interesting.
He noticed that in every sample he did the amount of Adenine was essentially equal to the amount of Thymine. The amount of Guanine was also equal to the amount of Cytocine.

He realized the amount of Adenine was not equal to the amount of Guanine and the amount of Thymine was not equal to the amount of Cytocine.

He also noticed this "rule" held true for any organism. Bacteria, plant, or human, the ratio of Adenine to Thymine were 1:1 as were Guanine and Cytocine.
This ratio became known as Chargaff's rules and became a key piece of evidence guiding Watson and Crick when they made their model of DNA.
How was the structure of
DNA determined?
Franklin and Wilkins
Wilkins and Franklin were both working in the
field of X-ray crystalography. They worked for
the same college, but had a very advisarial
relationship. Franklin was a woman scientist in
a man's world, she was not allowed to eat with
the men and they took great offense when she
pointed out the flaws in their ideas. Ultimately,
Wilkins stole Franklin's work and showed it to
James Watson who used it to create the model
of DNA.
X-ray crystalography is the technique of shooting x-rays at the atoms of a molecule
that has been turned into a crystal. The x-rays bounce off of the atoms at certain angles and then hit the film. The pattern that results can be analyzed and the shape of the molecules can be determined. Part of the success of this technique is having the molecule oriented in such a way that researchers get valuable information.
Maurice Wilkins was the first person to take a picture of the DNA molecule with X-ray crystalography. He worked for King's College in London, England. The picture helped researchers refine their models of DNA, but it still left many unanswered questions.
Rosalind Franklin was hired by King's College because of her expertise with X-ray crystalography. She took the photo at the left which shows the DNA molecule from the top down. This photo has become known as photo 51 and was stolen by Wilkins and shown to James Watson. Once he saw the "X" pattern he knew instantly that the structure of DNA was a double helix.
How was the structure of
DNA determined?
Watson and Crick
Rosalind Franklin
Maurice Wilkins
James Watson
Francis Crick
Erwin Chargaff
Frederick Griffith
Oswald Avery
Martha Chase and Alfred Hershey
Francis Crick began his career as a physicist. After his work was destroyed by a bomb during WWII he worked developing mines for the English. After the war he changed from physics to biology and began to research the properties of cytoplasm. After two years he began working with X-ray diffraction (which he taught himself) and trying to determine the structure of molecules (primarily proteins).
James Watson began his career as an ornithologist, someone who studied birds. He quickly became interested in genetics, specifically in molecular biology and the search for the molecule that transferred genetic material from parent to offspring. That search eventually led him to the Cavendish lab at King's College where he met Francis Crick and they formed a partnership to find the molecule, which they thought might be DNA,
The two researchers were primarily theoretical reseachers not experimental researchers. They decided to create a model of DNA based on the available research. The benifits of this approach meant they were not experimenting but synthesizing the concept from the existing research--in other words they were looking at all of the research and putting all of the parts together. Of course this left holes that needed to be filled, but they were at Cambridge University, if they were stuck they could find experts in Chemistry, Physics, and Biology to guide them and double check their work.
Their first model was completed and they asked Rosalind Franklin to come from King's College (a short train ride away in London England) to look at their model and give her expert opinion. She did come and immediately knew the model was wrong. She pointed out that the phosphate groups were on the inside and she knew they were hydrophillic (they love water) so they would be on the outside. This was only one of many problems she saw with the model. The meeting was short, to the point and once she explained the problems, she left them. This rejection of the model was such an embarassment that for a time they were forbidden to work on the model.
Linnus Pauling was a famous molecular biologist
who had discovered the structure of tha alpha
helix protein turned his attention to DNA. This
led Bragg (the head of the Cavendish) to grant
Watson and Crick permission to work on their
model. With information from Cambridge
chemists and pictures taken by Franklin (without
her permission), Watson and Crick were able to
construct a new model of DNA. They invited
Franklin back to look at the model and this time
she agreed the model was indeed correct. They
published their work in the science journal
Nature along with articles from Wilkins and
Franklin that supported their findings.
For their work on DNA, Watson , Crick, and Wilkins
won the Nobel Prize in Medicine. Franklin had died
and was not eligible for the award.
Watch ths video of Watson describing the process he and Crick went through to discover the structure of DNA.
Watson and Crick finally put the puzzle together and were able to determine the structure of DNA. Below is an explaination of what they and other researchers learned about how DNA is put together.
What is the structure of DNA?
What is the structure of DNA?
Terms you need to understand before you can understand the structure of DNA:
Double Helix: This is the idea that there are two strands of DNA that are joined together so they look like a ladder, then that ladder is twisted. It looks like this:
Phosphate group: This is the combination of a phosphorus atom that is bonded to four oxygen atoms. Together they make a phospate molecule that bonds with sugar molecules to make the backbone of the DNA molecule.
Grooves: when the ladder of the DNA molecule is twisted the spaces between the backbone (on the outside) are called grooves, there are two types: Major and Minor.
Deoxyribose: This is the sugar that is in DNA. It has 5 carbon atoms in it and together with the phosphate creates the backbone of the DNA molecule.
Polar: The arrangement or geometry of the atoms in some molecules is such that one end of the molecule has a positive electrical charge and the other side has a negative charge. If this is the case, the molecule is called a polar molecule, meaning that it has electrical poles. Otherwise, it is called a non-polar molecule. Polar molecules are attracted to each other, and non-polar molecules are attracted to each other.
Purines: The nitrogenous bases in DNA that make up the rungs of the DNA Ladder are grouped as either purines or pyrimidines. Purines have a chemical structure that has two rings in it. Like this:
Pyrimidines: The nitrogenous bases in DNA that make up the rungs of the DNA Ladder are grouped as either purines or pyrimidines. Pyrimidines have a chemical structure that has one ring in it. Like this:
Hydrogen bond: A hydrogen bond is a relatively weak bond that hydrogen atoms make with the electronegative atoms nitrogen, oxygen or fluorine. Hydrogen bonds are weaker than ionic, covalent, and metallic bonds. Hydrogen bonding can either be an intermolecular (between molecules) or intramolecular (between different parts of a molecule) bond. This type of bond can occur in both organic molecules, such as DNA, and inorganic molecules, such as water. Hydrogen bonding is partially responsible for the complex secondary and tertiary structure of proteins.
Complementary: The two strands of DNA are not exactly the same. One strand might have the nucleotide seuence of ATTGCA and the other would have the sequence TAACGT they are not identical, but they do match each other.
Planar: The nucleotide bases lay flat

Perpendicular: The nucleotide bases lie at a 90 degree angle to the sugar-phosphate backbone.
This video illustrates the major structural components of DNA.

*You should be familiar with the terms in the box above before you watch this video.
What is the structure of DNA?
DNA is called complementary or antiparallel. This video explains why. It has to do with the orientation of the carbons in the sugar part of the nucleotide.
How does a DNA molecule coil into a chromosome?
How does DNA replicate itself?
How does DNA transcribe its information into an RNA molecule?
How does RNA make a protein?
How does a chain of amino acids become a protein?
Thanks to Watson and Crick the world now understood the structure of DNA. DNA is made of billions of nucleotides, but where is DNA found in the cell? How does it fit into a tiny cell? How is it organized? Where are the genes Gregor Mendel first described a century and a half ago?
One of the primary tasks DNA has to accomplish is to make copies of itself. It needs to make a copy because cells continually divide. When a cell divides it needs its own DNA to tell it what proteins to make. DNA must copy the millions of base pairs it has every time the cell divides--Sometimes once every hour!
Besides making a copy of itself, the other job of DNA is to make proteins. DNA doesn't really make proteins, instead it carries the instructions for making proteins. The ribosome makes the proteins, the information has to get from the DNA to the ribosome. Transfering the information from DNA to the ribosomes is the job of mRNA. Copying the information from DNA onto mRNA is the process of transcription.
Once the mRNA is made, it moves from the nucleus where the DNA is (in eukaryotes) to the ribosome out in the cytoplasm. The message carried by the mRNA is used by the ribosome to make proteins.
The peptide chain has been made according to the instructions encoded onto the mRNA strand by the original DNA stand. However it still has one more process to finish before it is of use to the cell. It must fold into the right shape.
This is a chromosome. A chromosome is made of two things: DNA and proteins. The reason you need them is DNA is a long molecule, for example the chromosome in an E. coli bacteria has 4,639,221 bases. The DNA molecule has to fit inside of a tiny bacteria cell. Let's look at how small we are really talking:

DNA has to coil up tightly to become a chromosome. A human cell holds 46 chromosomes in the nucleus of each cell. Each strand of DNA is 5 cm long. 5 X 46 is 2.3 meters of DNA in every cell. A cell is smaller than this period. So 2.3 meters of DNA must fit into this period.
There is more DNA in a eukaryotic cell than a prokaryotic cell. So the chromosome in a a prokaryotic cell looks very different than a chromosome in a eukaryotic cell.
In a prokaryote the DNA circles around Histones forming nucleosomes.
Unlike Eukaryotes the DNA doesn't coil tightly. It stays relaxed as chromatin. The chromatin is attached to the cell membrane via a protein. The chromatin is circular, but bends around inside the cell. The chromatin is not in a nucleus, but in the cytoplasm.
In Eukaryotes the DNA coils into chromatin and is found in the nucleus of the cell. Most of the time the DNA stays in the chromatin state, but when the cell is going to divide the chromatin tightens into the chromosome shape we can see with a microscope.
In prokaryotes there are extra pieces of DNA outside the bacterial chromosome, these pieces of DNA are called plasmids. Plasmids contain DNA that helps the prokaryote adjust to the environment. For example, plasmids can produce proteins that help the bacteria fight antibacterial drugs.
DNA begins the coiling process by forming a nucleosome. First 8 proteins join together to make a histone. Next the DNA strand wraps around the histone twice. Finally a second histone bonds with the first histone, clamping the DNA to the structure. The two histones and the DNA combine to make a nucleosome.
The DNA continues to combine with Histones to make many (hundreds of thousands) of nucleosomes. These nucleosomes coil around each other to make chromatin. Chromatin exists in many states. It begins as the "beads on a string" form seen to the left. It also can coil tightly becoming more and more condensed.
When a cell divides the chromatin coils to its tightest state which creates a chromosome. DNA does not stay in the chromosome phase for long. Once cell division has occured then the chromosomes relax back into the less condensed chromatin state. DNA can only replicate and transcribe when it is relaxed in the chromatin state.
How does a DNA molecule coil into a chromosome?
How does a DNA molecule coil into a chromosome?
Here is a video that gives a quick and simple overview of DNA coiling into a chromosome.
Here is a video that gives a more in depth overview of DNA coiling into a chromosome. It is produced by the Howard Hughes Medical Institute.
How does DNA replicate itself?
How does DNA replicate itself?
What is replication? Replication is the process of a DNA strand making a copy of itself.
Why does DNA need to make a copy of itself? When a cell divides, each new cell needs a full copy of the DNA if it did not replicate there would be no DNA for one of the cells.
When does DNA make a copy of itself? Before the DNA coils into a chromosome. Chromosomes form just before the cell begins mitosis (cell division) the replication process must happen before that. (What form do we find the DNA in when it replicates?)
Where does replication happen? In a eukaryotic cell (cells with nuclei) replication occurs in the nucleus (specifically the nucleoplasm). Since prokaryotes don't have a nucleus replication occurs in the cytoplasm of prokaryotic cells (bacteria).
How does replication work? Before we go through the steps you should know a few things, like what enzymes are involved in replication? There are four enzymes involved in replication they include: helicase, DNA polymerase, RNA primase, and ligase. (Notice all four end with "ase")
What parts are needed for replication to happen? You need the original DNA strand. You need the four enzymes mentioned in the paragraph to the right. And you need nucleotides (lots of them). Nucleotides are the building blocks of DNA, they have three parts (this should be review) a nucleotide includes a sugar, a phosphate group, and a nitrogenous base (Adenine, Thymine, Cytosine, and Guanine).
Where are the parts of replication found? In prokaryotes (bacteria) they are found in the cytoplasm. In Eukaryotes (cells with a nucleus) they are found in the nucleoplasm (which is the jelly like fluid in the nucleus).
DNA Polymerase
RNA Primase
Cell nucleus
Original DNA
Steps of DNA Replication:
Step one
Helicase attaches to the chromatin and begins unwinding the DNA strand. It spins around 8000 times a minute. This is a fast process!
Step two
As the DNA strand unwinds it separates into two strands. This process does not begin at one end of the stand and move to the other. Instead it forms replication bubbles in several places along the DNA strand. This happens concurently along several locations. The individual copies are joined together later. The reason for this is the molecule is too long and it would take too long for replication to occur if it was just one spot that moved down the molecule.
Step three
The 5 prime (5') strand is called the leading strand and the 3' strand is the lagging strand. An RNA primer attaches to the leading strand just behind the helicase. The RNA primase is a small strand of RNA that has matching nucleotides. For example if the DNA code is GCGCCCGC then the RNA primer has a code of CGCGGGCG when ever the RNA primer detects the DNA code GCGCCCGC it will connect to the DNA strand.
Step four
The RNA primer attracts the DNA polymerase. This enzyme attaches to the DNA strand and "grabs" free floating nucleotides and puts them in the correct order. So if the DNA polymerase detects a thymine it will grab a nucleotide with adenine and then put in place (where hydrogen bonds form to hold it there). The DNA polymerase will move down the DNA strand towards the 3' end and look for the next nucleotide.
Step five
The lagging strand goes through a different process because it is 3'. DNA polymerase only moves from 5' to 3 prime so if the DNA polymerase attached behind the helicase it would have no where to go. Instead a loop of the lagging strand forms, this loop is called the okazaki fragment. The RNA primase binds to the lagging strand "downstream" and the DNA polymerase binds to it and works "upstream" (like in step four) until it gets to the end of the okazaki fragment.
Step six
A new okazaki fragment forms and step five repeats over and over within the replication loop.
Step seven
Now we have many small strands of DNA that are separated by RNA primase. Ligase comes along and "snips" the RNA primase out and "glues" the new DNA strands together, making one long complementary 5' strand.
Step eight
Once the new strands are copied DNA polymerase does its second job--proofreading. The enzyme moves back along the DNA strands and looks for mistakes in how the strand was put together. If it finds any mistakes it corrects them by cutting the wrong nucleotide out and replacing it with the correct nucleotide.
Now we have two strands of DNA each strand has one parent or old side and one daughter or new side. The two strands will now coil into nucleosomes and shortly begin to form chromosomes.
Step nine
You may need to watch this a couple of times. The first time just watch it and see how fast everything happens and how everything is happening at the same time. The second time try to identify the steps outlined above.
This video is from the Howard Hughes Medical Institute
How does DNA translate its information into an RNA molecule?
How does DNA translate its information into an RNA molecule?
How does RNA make a protein?
How does RNA make a protein?
How does a chain of amino acids become a protein?
How does a chain of amino acids become a protein?
What is transcription? Transcription is the process of transferring the information from the genetic code of DNA to a messenger RNA molecule.
What is RNA? RNA is a molecule called Ribonucleic Acid. It is very similar to DNA, but is different in three very important ways. 1) The sugar is ribose instead of deoxyribose. 2) There is only one strand instead of two. 3) There is no thymine--instead there is Uracil.
What is Uracil? Uracil is a nitrogenous base found only in RNA molecules. Uracil is a pyrimidine and it bonds with Adenine, a purine.
Why is RNA important? It depends, there are many types of RNA, tRNA and rRNA we will learn about when we study translation. For transcription we only need one kind of RNA it is called messenger RNA or mRNA. If there is no mRNA then there is no way for information to get from the gene to the ribosome.
What does mRNA do? mRNA carries information from the DNA molecule to the ribosome--which is where proteins will be made during translation.
When does mRNA carry the information? All the time. Anytime a protein is needed, mRNA is made to carry the information from the gene to the ribosome. The only time this doesn't happen is when DNA has coiled into a chromosome and cell division is taking place.
How does transcription happen? In replication we learned how DNA copies itself, mRNA is made in a similar way, but only one strand of DNA is copied.
What enzymes are needed for transcription? There is only one--RNA polymerase. There are some helper proteins, but we are going to focus only on RNA polymerase.
Where does transcription happen? The actual copying of DNA into an RNA molecule happens in the nucleus or the cytoplasm (depending on the type of cell). In Eukaryotes the finished mRNA will move out of the nucleus into the cytoplasm where the ribosomes are.
The first step of transcription is called pre-initiation. RNA polymerase and cofactors bind to DNA and unwind it, creating an initiation bubble. This is a space that grants RNA polymerase access to a single strand of the DNA molecule (a gene). That strand of DNA is called the antisense strand the one that is not copied is called the sense strand.
Step one: Pre-initiation
Step two: Initiation
Step five: Termination
Step three: Promoter clearance
Step four: Elongation
The initiation of transcription in bacteria begins with the binding of RNA polymerase to the promoter in DNA. The promoter is a sequence of nucleotides that the polymerase recognizes. Transcription initiation is more complex in eukaryotes, where a group of proteins called transcription factors help RNA polymerase bind to the DNA and begin transcription. These proteins still recognize the promoter region or sequence in the DNA molecule.
RNA polymerase must clear the promoter once the first bond has been synthesized. RNA polymerase needs a little help to stay on the job, approximately 23 nucleotides must be synthesized before RNA polymerase loses its tendency to slip away and prematurely release the RNA transcript.
One strand of DNA serves as the template for RNA synthesis, it works pretty much like DNA polymerase in that it grabs free floating nucleotides and matches them to the DNA strand's nucleotide sequence. Remember anywhere there would have been a thymine there is a uracil. This step of the process may repeat several times in a row so that many copies of a gene may be produced.
Termination is the final step of transcription. Termination results in the release of the newly synthesized mRNA from the DNA. The new mRNA strand will leave the nucleus through nuclear pores and move to the ribosome in the cytoplasm (eukaryotes). In prokaryotes the mRNA moves from the DNA to the ribosome too, but the whole process is happening in the cytoplasm.
Source: About.com--chemistry
Here is a video that demonstrates how transcription works. You may need to watch this a couple of times. The first time just watch it and see how fast everything happens and how everything is happening at the same time. The second time try to identify the steps outlined above.
This video is from the Howard Hughes Medical Institute
Here is a video that demonstrates how replication works. This video is better for showing why the okazaki fragment is needed than the one below, but the one below is better for realism.
A site: Where the correct tRNA molecule is selected. It is correct if it matches with the sequence on the mRNA strand.
P site: Once the tRNA has been accepted it moves to the P-site where it releases the amino acid. The amino acid is attached to a growing peptide chain.
E site: Once the tRNA has released the amino acid, it moves to the E-site-- where it is ejected from the ribosome.
Three nucleotides in a row on a mRNA strand make a codon. A codon matches for an amino acid.
The tRNA has an anticodon on the bottom of the molecule matches the codon on the mRNA strand.
A peptide chain is created by the addition of amino acids at the P-site of the ribosome. The peptide chain will fold into a protein.
When does RNA become a protein?
mRNA is made whenever the cell requires a specific protein. For each protein required an mRNA molecule is made. If the cell needs 100 proteins to make the enzymes needed for replication 100 mRNA strands are made and sent to the ribosome for translation.
Where does RNA become a protein?
mRNA is made made in the nucleus of eukaryotes and the cytoplasm of prokaryotes, but translation happens in the cytoplasm of both. Specifically translation happens in the ribosomes which are commonly found on the endoplasmic reticulum.
Why do we need RNA?
DNA is the blueprint our bodies use to make all of the proteins it needs for building blocks and workers. DNA is very valuable to us so to help protect the molecule, a copy of DNA is made to help the "master" last longer. mRNA is the "copy" that is used to build the proteins, thus helping to protect the DNA. This is not unlike you making a copy of pages of a textbook.
What is translation?
Translation is the process of the mRNA molecule being read by the ribosome which builds a protein out of amino acids brought to the ribosome by tRNA.
Why do we need proteins?
Proteins are needed for two main reasons. The first is they make enzymes. Enzymes are the workers in a cell and in a body. Some carry signals from one cell to another, others unwind DNA. The other reason is proteins are often the building blocks the body uses to make cell and body parts.
First Step
Second Step
Third Step
Are there more than one kind of RNA?
There are several kinds of RNA. All of them have ribose as a sugar which combines with phosphate groups making the backbone. Attached to the backbone is nitrogenous bases: Adenine, guanine, cytosine, and uracil. We will look at three types of RNA: mRNA which is a copy of DNA, rRNA which combines with proteins to make a ribosome, and tRNA which has an amino acid on one end and an anti-codon on the other.
What is a codon?
A codon is a combination of 3 nucleotides for example, on an mRNA strand there are thousands of nucleotides in a row, if the sequence starts AUCCGUACAUGGCGUGACUCAGAA it would be broken down into the following 8 codons: AUC CGU ACA UGG CGU GAC UCA GAA. Each codon codes for a specific amino acid. There are 64 possible codons and only 20 amino acids this means several codons code for the same amino acid. Also a few codons code for the process to stop. Codons match with the ant-codons on the tRNA molecule.
Here is the HHMI video animation of translation.
Step one
The mRNA comes from the nucleus (eukaryotes) and travels to the ribosome, found in the cytoplasm. The mRNA attaches to the ribosome at the A-site where it is matched to a tRNA's anti-codon.
Once the correct tRNA strand matches the codon on the mRNA it moves with the codon to the P-site of the ribosome. Here the amino acid is released from the tRNA and is attached to a growing peptide chain of amino acids.
Step two
Step three
After the tRNA has released the amino acid it moves with the codon on the mRNA to the E-site, where the tRNA releases from the codon and is ejected from the ribosome. The tRNA floats free and will eventually bond to another amino acid (determined by the anti-codon) and be used again.
Step four
The steps repeat over and over until the ribosome encounters a stop codon on the mRNA. A stop codon doesn't have an anti-codon match so the process stops and the peptide chain (now several hundred amino acids long) breaks free. This chain begins to fold into a shape and is now a protein.
To really understand why a protein folds you need to understand a little about the chemical structure of amino acids. Watch the video to learn more about the structure.
There are twenty amino acids. What makes them different is the R side chain. The atoms in the R chain determine the chemical properties of that amino acid. The chemical properties of the amino acid determine how the amino acids will fold into a protein.
The amino acids can be grouped into five categories:
Acidic--these amino acids have a negative charge, so they are attracted to basic amino acids.
Basic--these amino acids have a positive charge, so they are attracted to acidic amino acids.
Hydrophobic--these amino acids typically are not polar and are repelled by water. Since cytoplasm is mostly water these amino acids try to fold into the center of the molecule where they don't have access to water.
Polar--these amino acids are attracted to the water in cytoplasm because water is polar and polar likes polar. They will fold to be exposed to the outside of the protein.
Cystines--these amino acids are attracted to other cysines so they will fold to be near other cysteines.
Chemical Properties of Amino Acids
Levels of protein folding:
Primary Structure
This is the specific sequence of amino acids. It is the long chain before any actual folding happens.
Secondary Structure
As the peptide chain forms hydrogen bonds form between hydrogen atoms and oxygen or nitrogen atoms. This causes the peptide chain to either form a helix--called an alpha helix or sheets folded like a fan--called beta sheets.
Tertiary Structure
Now that there is a secondary structure the peptide chains fold more because of the chemical properties mentioned above. This creates the tertiary structure.
Quadinary Structure
Many proteins only have a tertiary structure, but sometimes several peptide chains combine to make a complicated protein this is this level.
Full transcript