Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Master thesis

No description
by

João Cruz

on 9 February 2016

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Master thesis

Transposon mutagenesis - Creation of M145 pyc::Tn5062
8
The Phosphoenolpyruvate-Pyruvate-Oxaloacetate node in Streptomycetes: a study on pyruvate carboxylase
Streptomyces coelicolor A3(2)
Actinobacteria

Saprophytic bacterium

Bioactive molecules

Complex life cycle

Low Reproducibility
Characterize Pyruvate Carboxylase in PEP-PYR-OAA Node
Gene Knockout
Phenotypic Characterisation
M145
Ace
Cit
Pyr
GlcNAc
Twe
Minimal medium +
Glc
R5
R2YE
R2
The Phosphoenolpyruvate-Pyruvate-Oxaloacetate-Node
Pyruvate Carboxylase
Strategy
Gene knockout
Transposon Tn5062 introduced in SuperCosmid1
Complementation
Amplification SCO0546
Ligation to pGEM-T
Digestion with EcorI
Results confirmed by sequencing
Transformation into ET12567/pUZ8002

Conjugation

Screen differences in phenotype
Biochemichal Characterization
Fragment Size: 3840 bp
No activity from pyc
Substrate inhibition
Enzymatic Assay
Microscopy
Pyruvate Carboxilase
Life cycle was not disturbed

No differences found

Enzyme not involved in the development
Primers
SCO0546Fw
AGGCTGAAGGGATCAAGAATGT
SCO0546Rv
GTCGAGCACTTCAACAAGTACG
Lane 0 - 1 Kb Promega ladder
Lane 1 - PCR aamplification
pJC_01_pyc::Tn5062
3858 bp
2997bp
Invitro Digestion
Fragment Size: 3375 bp
Primers
SCO0546Fw
CACCATGTTCCGCAAGGTGCTG
SCO0546Rv
TCAGGCGAGTTGGACGAGAAGATC
Lane 0 - 1 Kb Promega ladder
Lane 1 - PCR amplification
Ligation to pet100 D-TOPO
Digestion with EcorV and PstI

pJC_03_pyc
4909 bp
3285 bp
945 bp
0
Lane 0 - 1 Kb Promega ladder
Lane 1 - Sample 1
Lane 2 - Sample 2
Lane 3 - Sample 2 Undigested
TOPO vector
3285 bp
1534 bp
945 bp
in sillico digestion
Problem!!
1
3
4
5
6
12
PCx
ATP
+
+
ADP + P
+
2
Conjugation into Wildtype - M145
Screen for double crossovers
Anaplerotic functions
Complementation
Enzymatic assay
Phenotypic characterisation
Score = 561 bits (1446)
Expect = 0.0
Identities = 305/325 (94%)
Positives = 306/325 (94%)
Gaps = 1/325 (0%)
Frame = +1
Utter and Keech, 1960
Lane 0 - 1 Kb Promega ladder
Lane 1-5 - Sample 1-5
Biotin-containing enzymes
Carboxylation of pyruvate to oxaloacetate
Overexpression
1- Inverted Repeats
2-Translational STOP codon
3-Streptomycete RBS
4-EGFP
5-T4 Terminators
6-Aac(3)IV - Apramycin
7-Origin of Transfer
Tn5062
in sillico Digestion
21924
10877
7687
6664
1022
841
699
694
Δ
Transformation into ET12567/pUZ8002
Digestion with HindIII and XhoI
Contruction of pJC_02_pyc::Tn5062 Ligation to pIJ6902
M145 pyc::Tn5062
M145 pyc::Tn5062
M145
Growth Curve
Final Remarks
References
Amplification SCO0546
Molecular Weight = 31.34 kDa
9
11
13
14
15
Bentley, S.D., et al., Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature, 2002. 417(6885): p. 141-7.
Butler, M.J., et al., Engineering of primary carbon metabolism for improved antibiotic production in Streptomyces lividans. Appl Environ Microbiol, 2002. 68(10): p. 4731-9.
Conn, J.E., The Pigment Production of Actinomyces coelicolor and A. violaceus-ruber. J Bacteriol, 1943. 46(2): p. 133-49.
Hobbs, G., et al., An integrated approach to studying regulation of production of the antibiotic methylenomycin by Streptomyces coelicolor A3(2). J Bacteriol, 1992. 174(5): p. 1487-94.
Hojati, Z., et al., Structure, biosynthetic origin, and engineered biosynthesis of calcium-dependent antibiotics from Streptomyces coelicolor. Chem Biol, 2002. 9(11): p. 1175-87.
Hopwood, D.A., Forty years of genetics with Streptomyces: from in vivo through in vitro to in silico. Microbiology, 1999. 145 ( Pt 9): p. 2183-202.
Sauer, U. and B.J. Eikmanns, The PEP-pyruvate-oxaloacetate node as the switch point for carbon flux distribution in bacteria. FEMS Microbiol Rev, 2005. 29(4): p. 765-94.
Peters-Wendisch, P. G., C. Kreutzer, et al. (1998). "Pyruvate carboxylase from Corynebacterium glutamicum: characterization, expression and inactivation of the pyc gene." Microbiology 144 ( Pt 4): 915-927.
Petra G. Peters-Wendisch, V.F.W., Susanne Paul,Bernhard J. Eikmanns, Hermann Sahm, Pyruvate carboxylase as an anaplerotic enzyme in Corynebacterium glutamicum. Microbiology 1996. 143(4): p. 8.
Ventura, M., et al., Genomics of Actinobacteria: tracing the evolutionary history of an ancient phylum. Microbiol Mol Biol Rev, 2007. 71(3): p. 495-548.
White, J. and M. Bibb, bldA dependence of undecylprodigiosin production in Streptomyces coelicolor A3(2) involves a pathway-specific regulatory cascade. J Bacteriol, 1997. 179(3): p. 627-33.
T.N. Zeczycki, M.St. Maurice, P.V. Attwood, Inhibitors of Pyruvate Carboxylase. Open. Enzy. Inhib. J., 3 (2010), pp. 8–26
Mc, G. J. (1954). "Nuclear division and the life cycle in a Streptomyces sp." J Gen Microbiol 11(1): 52-56.
Aim of the work
Study it's effect on Antibiotic Production
To understand the role of PEP-PYR-OAA-Node in Streptomyces
João Cruz
Major carbon flux control point


Metabolic link between glycolysis/gluconeogenesis and the TCA cycle


Antibiotic precursors molecules - Polyketide Molecules


C3-carboxylating enzymes: Pyruvate Carboxylase
Achieve clone for complementation and overexpression


Integrate data with remaining PEP-PYR-OAA node reactions
pGEM-T
3015
Integrative vector


Optimization required!!
Slower Growth

Increased Actinorhodin Production

Different from solid media
Alignment Results
Pyruvate Carboxylase has an impact on Antibiotic Production
Confirmation of SC_JC_01_pyc::Tn5062
Lane 0 - PstI Marker
Lane 1-2- Sample 1-2
Lane 3 - HindIII Marker
mol/mL
U/mg
Small scale screening in liquid medium
Slower Growth

Increased
Actinorhodin production

High Variability
Supervisors:
Nuno Gonçalo Pereira Mira, Departamento de Bioengenharia (DBE)
Paul A. Hoskisson, University of Strathclyde, Glasgow, UK

21 Sep 2012
st
STEP 3
Overexpression
Lane 0 - 2-212 kDa NEB protein Marker
Lane 1 - Cell pellet After induction
Lane 2 - Supernatant After Induction
Lane 3 - Cell pellet Before Induction
Lane 4 - Cell Debris
66.4










27.0
Pyruvate carboxylase, HisTrap, 1M imidazole
Lane 5 - Flow-through
Lane 6 - Wash
Lane 7 - Purified Sample 1
Lane 8 - Purified Sample 2
Lane 9 - Purified Sample 3
Transformation into BL21
Purification
34.6
Enzymatic Assay - conditions
DeForchetti and Cazzulo, 1975
Bioinformatic Analysis
Conserved domains
Broad range of species
Actinorhodin - Blue
Undecylprodegiosin - Red
Green
pH 8,5
Room Temperature
Blue
pH7
30ºC
Red
pH 7
Room Temperature
1 unit of PCx = 1 oxidized molecule of NADH per minute
7
10
CDW
Act
Full transcript