Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Uso da Plataforma Galaxy para Análise de Dados de RNA-seq

Aula dada no Curso de Bioinformática da Embrapa Gado de Corte, 9/11/2012
by

Felipe Rodrigues da Silva

on 10 April 2014

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Uso da Plataforma Galaxy para Análise de Dados de RNA-seq

Transcritos
EST – Expressed Sequence Tag
DNA
RNA
proteína
Dogma Central da Biologia
clonar
sequenciar
Galaxy
para Análise de Dados de RNA-seq
Felipe Rodrigues da Silva
Lab. de Bioinformática Aplicada - LBA
Lab. Multiusuário de Bioinformática - LMB
Embrapa Informática Agropecuária
felipes@cnptia.embrapa.br
Sequenciamento de
Próxima Geração - NGS

X
Unidades de serviço

Unidades de pesquisa de produtos

Unidades de pesquisa de temas básicos

Unidades de pesquisa agroflorestal ou agropecuária nas ecorregiões brasileiras
Embrapa
No século passado!
Biologia na Unicamp
1989
Embrapa Algodão
Embrapa Arroz e Feijão
Embrapa Caprinos e Ovinos
Embrapa Florestas
Embrapa Gado de Corte
Embrapa Gado de Leite
Embrapa Hortaliças
Embrapa Milho e Sorgo
Embrapa Pesca, Aquicultura
Embrapa Soja
Embrapa Suínos e Aves
Embrapa Trigo
Embrapa Uva e Vinho
Embrapa Mandioca e Fruticultura
Embrapa Agrobiologia
Embrapa Agroenergia
Embrapa Agroindústria de Alimentos
Embrapa Agroindústria Tropical
Embrapa Estudos e Capacitação
Embrapa Informática Agropecuária
Embrapa Instrumentação
Embrapa Meio Ambiente
Embrapa Monitoramento por Satélite
Embrapa Recursos Genéticos e Biotecnologia
Embrapa Solos
Embrapa Mato Grosso
Embrapa Meio-Norte
Embrapa Pantanal
Embrapa Rondônia
Embrapa Roraima
Embrapa Semiárido
Embrapa Tabuleiros Costeiros
Embrapa Acre
Embrapa Agropecuária Oeste
Embrapa Amapá
Embrapa Amazônia Ocidental
Embrapa Amazônia Oriental
Embrapa Cerrados
Embrapa Clima Temperado
Embrapa Café
Embrapa Gestão Territorial
Embrapa Informação Tecnológica
Embrapa Produtos e Mercado
Embrapa Quarentena Vegetal
5
14
17
11
informática
Como eu fui parar lá?
1983 - Tia Nini
1991 - AAoW
1992 - Bacherelado
1996 - Mestrado
1997 - Grupo Genoma CBMEG
2001 - Doutorado
2009 - Posdoc - IC
1992 - 386 Colorido!
9.660
empregados
2.392
pesquisadores
(24.8%)
74% - doutores
7% - posdocs
Orçamento 2012
R$ 2,1 bilhões.
+
(bio)
=
http://www.embrapa.br/a_embrapa/missao_e_atuacao
Adhemar Zerlotini Neto
Francisco Pereira Lobo
Formato fastQ
@HS2_07083:2:1206:14255:166166#2
TGAGTAGATAAAATTTGACAACAATCTAAAGGCATTATTAAGTAATCAGAATCATTTTCAGTAGAACCAATCCCT
+
<BEHEID>JFJKKKLGKNJIJKJEHKELKMLFKLIIIMLLMHGJLIFFFILJCGLLCMIHJDLEKJH9E:LJH8B
@HS2_07083:2:1206:14255:166166#2
TCCAGGGTGGACAATAAGACCTTGTAGGCTGCAAGAGCCTGCCTCTGTCATTCTGGCCACAAAATCTGAGAAGGA
+
1LJIDNJ5MGL3KKDJFC+KHMHGIDKBG?BKCJ@96IFKBJIHGICIEGIEJJKJHILCJGKKIKHIFGFFED9
@HS2_07083:2:1207:20616:121747#2
CAAAATTCCAACTCAATTCTTCAACGAATTGGAAGGAGCAATTTGCAAATTTGTCTGGAATAACAAAAAACCTAG
+
7DEDEGFIKKHKIHJJLLGJHJKKKIJIKGKLIJLKJHMHLEMKJIJFGKKLDMKMIKKGDDIJLJMMMNJIJLJ
>HS2_07083:2:1206:14255:166166#2
TGAGTAGATAAAATTTGACAACAATCTAAAGGCATTATTAAGTAATCAGAATCATTTTCAGTAGAACCAATCCCT
>HS2_07083:2:1206:14255:166166#2
TCCAGGGTGGACAATAAGACCTTGTAGGCTGCAAGAGCCTGCCTCTGTCATTCTGGCCACAAAATCTGAGAAGGA
>HS2_07083:2:1207:20616:121747#2
CAAAATTCCAACTCAATTCTTCAACGAATTGGAAGGAGCAATTTGCAAATTTGTCTGGAATAACAAAAAACCTAG
Formato fasta
>HS2_07083:2:1206:14255:166166#2
9 9 9 6 6 6 4 6 4 4 4 4 4 7 9 8 8 7 4 4 9 9 7 7 4 0
4 19 20 27 32 29 20 15 4 0 4 7 7 9 19 23 24 18 10 10
6 9 15 17 31 28 27 13 12 8 8 9 12 19 31 48 44 46 46
46 46 46 35 35 35 35 35 35 46 46
>HS2_07083:2:1206:14255:166166#2
6 6 4 4 4 4 6 6 6 6 6 7 7 7 8 8 22 15 15 4 4 4 9 16
17 27 18 18 15 20 12 14 18 27 32 32 32 29 29 29 29
29 29 29 29 29 29 42 42 33 32 32 40 40 37 40 37 35
35 35
>HS2_07083:2:1207:20616:121747#2
4 4 4 6 4 7 7 7 7 10 10 8 4 0 4 8 8 13 23 19 12 9 8
19 13 15 14 20 19 28 21 16 16 23 29 40 40 56 56 56
51 51 46 46 46 46 51 51 51 51 51 56 51 51 51 39 39
39 39 39 39 40 40 46 46 51 51 51 40 40 40 39 35 35
35 39
arquivo .qual
Galaxy
Exercício com RNAseq
http://www.cnptia.embrapa.br/~felipes/Galaxy/
ferramentas
dados
história
Dados
processados
cinza: na fila
amarelo:
processando
verde: pronto
no LMB
RNAseq,
sem saber programar
sem saber *nix
várias ferramentas na mesma interface
mesmo depois que se apagam os dados
pode salvar a sequência de passos (workflow)
,
etc.
NGS: QC and manipulation
FASTQ Groomer
NGS: RNA Analysis
Tophat for Illumina
cuffcompare
guarda todos os passos (e parâmetros) das análise
Francisco Lobo
Caminho...
felipe.silva@embrapa.br
Uso da Plataforma
Adhemar Zerlotini Neto
http://cnptia.embrapa.br/~felipes/CNPG2012.htm
Full transcript