Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Forensics

No description
by

Isaiah Linares

on 17 February 2014

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Forensics

Forensics
What is forensics?
The study of evidence found at a crime scene and the use of science in the field of law.
Provides impartial scientific evidence for use in the courts of law, and in a criminal investigation and trial.
Examples of how Forensics is being used for evidence in court cases
DNA Profiling
Fingerprint Identification
Blood Samples
Footprints/Shoe prints
Hair Samples
Vehicles
Toxicology in the human body
Dust,dirt, etc.
Gunshot residue
Forensic evidence provides significant information for solving crimes and finding the criminal(s).
Basic description of the technique of DNA profiling
Benefits of Forensics
Forensics has affected students positively by encouraging emotional maturity and conflict-resolution skills. It has encouraged civic engagement and political participation.
Forensics has also yielded higher productivity and a better quality life in students.
Forensics has helped in identifying individuals involved in crimes or criminal activity and victims of disasters.
Forensics has helped in exonerating the innocent, with the many techniques and technology. Forensics has made at least 250 individuals in the United States get justice after being convicted of a crime they did not commit.
Dangers of Forensics
Diseases of a dead body could still be alive in the person's tissue or bodily fluids, so scientists in forensics need to limit their exposure.
Work environment: Most scientists in labs spend their day standing and working in the lab, potentially causing physical fatigue or stress.
Hazardous conditions: Most forensic scientists often visit a scene clueless of what the scene could be like. Scenes could range from a rough outdoor terrain to an unsanitary basement
Psychological stress: After witnessing the aftermath of brutal crimes or violent deaths, it can take an emotional toll over time. The scientists must be mentally and psychologically prepared for different scenarios and situations.
The process of obtaining a specific DNA pattern (profile) from a person or sample of bodily tissue.
STR (Short tandem repeats) are regions of non coding DNA that contain repeats of the same nucleotide sequence. For example, GATAGATAGATAGATAGATAGATA is a STR where the nucleotide is repeated six times.
To produce a DNA profile, scientists examine STRs at ten or more genetic loci. The specific location of a gene or DNA sequence or position on a chromosome.
DNA profiling is used as evidence in court cases, like identifying the probable origin of a body fluid sample associated with a crime or crime scene.
Freeman, Shanna. "How DNA Profiling Works." HowStuffWorks. HowStuffWorks.com, 19 Aug. 2008. Web. 15 Feb. 2014.
"Two-Minute Science Lesson: How Forensic DNA Testing Works." YouTube. YouTube, 20 July 2011. Web. 15 Feb. 2014.
"Neglecting Forensic Science Threatens Justice, MPs Warn." The Telegraph. Telegraph Media Group, 25 July 2013. Web. 13 Feb. 2014.
Ethics of Forensics
The manipulation, mishandling, and misinterpretation of forensic evidence can have damaging effects on criminal cases.
Many people disagree with DNA profiling, as they do not trust people with their identification, not knowing what the scientists could do with it or if some criminal could get a hold of their identification somehow.
Forensics affect on medicine
Forensic pathologists, or medical examiners, are specially trained physicians who examine dead bodies.
They determine the identity of the victim and the time, manner, and cause of death.
The forensic pathologist studies the medical history, performs an autopsy to uncover evidence of injury or disease, and collects medical and traces evidence from the body for further analysis.
In addition to anatomy, the scientist may draw up toxicology, serology (blood analysis), and use DNA technology.
Forensics and the environment
by Robert, Isaiah, and Mohammed
Forensic science has a positive effect on the environment.
Environmental forensic scientist identify petroleum-related and other potentially hazardous environmental contaminants.
They also determine their sources and time of release.
Releases of potentially harmful substances on the environment can destroy habitats and kill many animals.
By identifying the cause and source of release, a legal claim can be made against the responsible party, causing them to stop the pollution of the environment.
Also if contamination was accidental, they can get the responsible party to fix their pipes, factory, etc.
Forensics affect on society
Forensics has a positive affect on society.
With forensics, we are able to identify the people who commit crimes and have strong evidence to prove the criminals guilty.
Forensics helps get more criminals off the streets quicker, keeping the rest of the society safer from threats and criminal danger.
Less criminals in a community, the better the community looks (Low crime rate).
Investigations of accidents by forensic scientist lead to improvements in safety in transportation, workplace, public venue, etc.
Forensics affect on individuals
Group Opinion on Forensics
Forensics has a positive effect on individuals.
People who are wrongly accused of a crime, have a better chance of being found "not guilty" due to forensic evidence.
Forensic evidence also helps release innocent people who were put in jail for crimes they didn't commit. Forensic scientist may find evidence that proves somebody else commited the crime.
We believe forensic science should continue to be improved on as it is a great idea and is overall beneficial.
Forensics overall is a very accurate and ethical way to aid in investigations and solving crimes.
Forensics has no negative effects on society and without it, solving crimes would mostly be based on assumptions and no evidence, which would make it extremely difficult.
Pearson Education Inc, Prentice Hall Forensic Science, Sun Feb 16
Minnesota Department of Education,
MAFIN - MIDWEST AUTOMATED FINGERPRINT IDENTIFICATION-NETWORK, Sun, Feb 16
My name was used falsely in an arrest, IdentityTheftVictims, Sun Feb 16
SH648,Evidence-based systematic reviews: As close to certainty as it gets, April 20 2010
Works Cited
"DNA Profiling." Biotechnology Learning Hub RSS. Biotechnology Learning Hub, 01 Dec. 2005. Web. 16 Feb. 2014. <http://www.biotechlearn.org.nz/focus_stories/forensics/dna_profiling>.This
website gave us a very thorough break down of DNA profiling.
"Forensic Pathologist." Explore Health Careers.org. Explore Health Careers, n.d. Web. 14 Feb. 2014. <http://explorehealthcareers.org/en/Career/129/Forensic_Pathologist>.This website gave us information about working in a job dealing with forensics, a medical examiner.
"Forensic Sciences." NIJ Home Page NIJ Home. National Institute of Justice, 29 Mar. 2013. Web. 16 Feb. 2014. <http://www.nij.gov/topics/forensics/Pages/welcome.aspx>.This website told us exactly what forensics was.
"IN THE SPOTLIGHT." NCJRS. National Criminal Justice Reference Service, n.d. Web. 16 Feb. 2014. <https://www.ncjrs.gov/spotlight/forensic/summary.html>.This website gave us reliable, in depth information on forensics and examples.
"Introduction to Environmental Forensics." DPRA - Isotope and Hydrocarbon Forensic Analysis Laboratory (Zymax). DPRA/Zymax, n.d. Web. 16 Feb. 2014. <http://www.dpra.com/index.cfm/m/157>.We receive our information on how forensics affects the environment from this website.
"MAFIN - Midwest Automated Fingerprint Identification-Network." Bureau of Criminal Apprehension. Minnesota Department of Public Safety, n.d. Web. 16 Feb. 2014. <https://dps.mn.gov/divisions/bca/bca-divisions/forensic-science/Pages/midwest-automated-fingerprint-identification-network.aspx>.We Received a photo from this website.
Marsden, Sam. "Neglecting Forensic Science Threatens Justice, MPs Warn." The Telegraph. Telegraph Media Group, 25 July 2013. Web. 16 Feb. 2014. <http://www.telegraph.co.uk/news/uknews/crime/10201340/Neglecting-forensic-science-threatens-justice-MPs-warn.html>.We received a picture from this website and more information on why forensic science is so important.
"PCR in Forensic Science." ABPI Resources for Schools. ABPI, n.d. Web. 16 Feb. 2014. <http://www.abpischools.org.uk/page/modules/pcr/pcr3.cfm?coSiteNavigation_allTopic=1>.This website gave us an example of forensic science.
Refuge, Jeshayah. "Ethics and Training in Forensic Science." Crime Scene Investigator Network. Crime Scene Investigator, 24 June 2011. Web. 16 Feb. 2014. <http://www.crime-scene-investigator.net/ethicsinforensicscience.html>.This website gave us information on the ethics involved in forensics.
"Welcome to What Is Forensic Science? Faculty of Sciences." What Is Forensic Science? Staffordshire University, 27 Jan. 2011. Web. 14 Feb. 2014. <http://www.staffs.ac.uk/schools/sciences/forensic/whatisforsci/whatisforensicsci/>.We got an intro into forensics with this website.
Full transcript