Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

NanoRosetta- Kickstarter to Cooperatively Archive the Human Genome

An overview.
by

Jakub Svec

on 11 April 2013

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of NanoRosetta- Kickstarter to Cooperatively Archive the Human Genome

Ancient civilizations preserved fragments of their culture by chiseling information into hard stone. WEIGHT:
1700lbs NanoRosetta Kickstarter to Cooperatively Archive the Human Genome NanoRosetta applies this same principle to etch information into nickel discs. This is an actual page from the King James Bible, retrieved with a microscope. These nickel plates have a life cycle of 10,000+ years and require little to no maintenance. Preserve something until the year 12,013. 10,000 years ago, human civilization was in the Neolithic Period (10,000BC-2,000BC). which is exactly why the University of Leicester did it. Each page is 1/3mm x 1/3mm. 130 Volumes If each page was laid side-by-side... History of Long-Term Archiving NanoRosetta Archiving ... it would measure 6 feet long. gattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagatta Become a Custodian
of the Human Genome ...if the DNA within a single human cell were uncoiled... 33 letters from the Bible can fit across
the width of a human hair. At this size, 50 Bibles can be printed on a single disc. ...with over 3.2 billion base pairs... The Human genome is long. NanoRosetta:
Archiving the Human Genome Or become a NOTED SUPPORTER. $5 $20 For $5, NanoRosetta will print your
NAME, BIRTH YEAR and HOME CITY
into every set of Human genome discs. For $20, NanoRosetta will also print an image of you into every set of discs. +$5 Add a family member to your photo for an additional $5. $1250 To print one set of discs, the cost is over $50,000. So if you know
someone in ,
forward this Kickstarter. Or someone
in ... Extraterrestrial options are also being pursued.
NanoRosetta will also be donating a select few sets to wonderful institutions around the world. Like the
Long Now
Foundation
in And the
Internet Archive
in .

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child

Child ...and handed down to your children. Who can hand it down to their children... ...300 times. With economy of scale, the cost is brought down to $1250 per set. DONATING- The Rosetta Stone A lot more will happen in the next 10,000 years. It took... ... in every part of the world... Printing 3.2 billion characters on paper is impractical... Jakub Svec 1986
Prague, Czech Republic Jakub Svec 1986
Prague, Czech Republic With NanoRosetta, the Human genome The goal is
multiple sets in the hands of multiple custodians... ...or someone
trekking to ,
let them know. Background About Us The Human Genome The Kickstarter (about half the weight of a car) & (as old as Christianity) AGE:
2100 YEARS Jakub Svec 1986
Prague, Czech Republic Bruce Ha
Ho Chi Minh City,Vietnam NanoRosetta Team John Bishop
Santa Fe, New Mexico, USA gattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacavgattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagatt 300 pages per book


4pt font With... In... These discs can be framed... ...it would cover... YOU fits on 5 discs. With a goal of $100,000... Jakub Svec 1986
Prague, Czech Republic Jakub Svec 1986
Prague, Czech Republic Jakub Svec 1986
Prague, Czech Republic Bruce Ha 19??
????????,Vietnam NanoRosetta Team Chris Cotton 19??
?????,????? John Bishop 19??
?????,????? These are actual images retrieved from nickel discs. together we can make it happen. Help us make it happen.
Full transcript