Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Monsters Within Us

No description
by

eli sanchez

on 6 February 2014

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Monsters Within Us

tRNA
Glycine, Glumatic Acid, Aspartic Acid. Alanine, Valine, Arinine, Serine, Lysine, Asparagine.
Threonine, Methionine, Isoleucine, Arginine, Glutamine, Histidine, Proline, Leucine,Tryptophan.
Stop, Cytenine, Stop, Tyrosine, Serine, Leucine, Pheraldanine, Glycine, Glmatic Acid.
Aspartic Acid, Alanine, Valine, Arginine, Serine, Lysine, Asparagine, Threorine, Methionine.
Isoleucine, Aginine, Glutanine, Histidine, Proline, Leucine, Trytophan, Cytenine,Stop.
Stop, Tryrosine, Serine, Leucine, Pheraldainine, Glycine, AcidGlumstic, Aspartic Acid, Alanine
DNA Sequences
GGAGAGGATGCTGTAAGAAGCAAAAAC CCTCTCCTACGACTATCTTCGTTTAAC
ACAATGATCCGACAGCACCCCCTGTGG TGTTACTAGGCTGTCGTGGGGGACACC
TGATGCTAATACTCCTTGTTTGGGGAA ACTACGATTATGAGGAACAAACCCCTT
GACGCGGTGAGGAGCAAGAATAGCATG CTGCGCCACTCCTCGTTCTTATCGTAC
ATACGGCAGCACCCGCTGTGGTGCTGA TATGCCGTCGTGGGCGACACCACGACT
TAGTAGTCGTTGTTCGGTGAAGATGCT ATCATCAGCAACAAGCCACTTCTACGA
GTTAGAAGTAAAAATACTATTTTTTTG CAATCTTCATTTTTATGATAAAAAAAC
TCATATTAATGCTAACTTCCTCATCGA AGTATAATTACGATTGAAGGAGTAGCT
GCGATACGCTATGTCGGGAAATTTCCC CGCTATGCGATACAGCCCTTTAAAGGG
CGGGCTAAAAAGTTATAGCCCCCGTGA GCCCGATTTTTCAATATCGGGGGCAGT
mRNA Sequences
GGAGAGGATGCTGTAAGAAGCAAAAAC CCUCUCCUACGACUAUCUUCGUUUAAC
ACAATGATCCGACAGCACCCCCTGTGG UGUUACUAGGCUGUCGUGGGGGACACC
TGATGCTAATACTCCTTGTTTGGGGAA ACUACGAUUAUGAGGAACAAACCCCUU
GACGCGGTGAGGAGCAAGAATAGCATG CUGCGCCACUCCUCGUUCUUAUCGUAC
ATACGGCAGCACCCGCTGTGGTGCTGA UAUGCCGUCGUGGGCGACACCACGACU
TAGTAGTCGTTGTTCGGTGAAGATGCT AUCAUCAGCAACAAGCCACUUCUACGA
GTTAGAAGTAAAAATACTATTTTTTTG CAAUCUUCAUUUUUAUGAUAAAAAAAC
TCATATTAATGCTAACTTCCTCATCGA AGUAUAAUUACGAUUGAAGGAGUAGCU
GCGATACGCTATGTCGGGAAATTTCCC CGCUAUGCGAUACAGCCCUUUAAAGGG
CGGGCTAAAAAGTTATAGCCCCCGTGA GCCCGAUUUUUCAAUAUCGGGGGCAGU
Traits
2 Eyes
2 Arms
6' Tall
2 Legs
Black Eyes
2 Hands
2 Feet
3 Fingers and 3 Toes
White Body
No Teeth
Amino Acid Chain Key
You can know which amino acis chain is which because they are all in order from 1-10 with each bullet point.
Mutation Types
Substitution- A substitution is a mutation that exchanges one base for another.
Insertion-Insertions are mutations in which extra base pairs are inserted into a new place in the DNA.
Deletion-Deletions are mutations in which a section of DNA is lost, or deleted.
Frameshift-Since protein-coding DNA is divided into codons three bases long, insertions and deletions can alter a gene so that its message is no longer correctly parsed. These changes are called frameshifts.
Monsters Within Us
They would start to make copies because the DNA would get damaged and would not do the correct things which was called mutation. Some causes would be like UV radiation and smoke and sometimes age.
More
Valine, Asginine, Serine, Lyusine, Asparagine, Threonine, Isoleucine, Pheraldanine, Leucine.
Serine, Tyrosine, Stop, Tryplophan, Stop, Leucine, Proline, Hisitidine, Arinine.
Alanine, Isolencine, Arginine, Tyrosine, Valine, Glysine, Lysine, Phenylalanine, Proline.
Arginine, Alainine, Lysine, Lysine, Stop, Stop, Proline, Proline, Stop.
Mutation
Substituion, Deletion, and Instertion is not that bad it just make a different sequences.
Frameshift is the worts because they can change the whole DNA sequences making it bad or causing problems.
They would start to make copies because the DNA would get damaged and would not do the correct things which was called mutation. Some causes would be like UV radiation and smoke and sometimes age.
Making
Full transcript