Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Barcoding

No description
by

Cristina Logacho

on 17 June 2013

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Barcoding

Barcoding (Código de barras genético)
INTRODUCCIÓN
¿Cómo funciona el código de barras de ADN?
Conclusión
Herramienta desarrollada en el año 2003
Paul Herbert
Consiste en una secuencia corta de ADN de condiciones uniformes dentro del genoma utilizada para identificar cualquier especie de ser vivo
Consiste en el uso de una secuencia corta y estandarizada del genoma para la identificación de especies.
Animales se utilizan 648 pb de un determinado gen mitocondrial (citocromo c-oxidasa subunidad 1)
Plantas es más complicado y se utilizan secuencias de al menos 2 genes de los plástidos
De la misma manera que un escáner de supermercado, el cual se usa para distinguir productos usando rayas negras llamadas UPC.
Las secuencias de genes y nucleótidos en el ADN dentro de cada especie es única. Una secuencia de 15 nucleótidos, con 4 opciones en cada posición, crea la posibilidad de 1 billón de códigos
Aplicaciones del Barcoding
Identificación de hojas de la planta
Identificación de las larvas de insectos
Identificación de la dieta de un animal
Identificación de los productos en el comercio
Elección del locus
Debe ser lo suficientemente corto como para ser fácilmente secuenciados con la tecnología actual.
Proporcionar una gran variación entre las especies incluso si ésta no es muy grande.
Producción de código de barras genético
Así que si usted escribió la secuencia de código de barras de
un mosquitero boreal (Phylloscopus borealis), por ejemplo, se vería así:

CCTATACCTAATCTTCGGAGCATGAGCGGGCATGGTAGGC ....

Y la imagen se ve así:


BOLD
La secuencia está representada por
una serie de letras CATG que
representa los ácidos nucleicos
- citosina, adenina, timina y guanina.
ADNmt se heredan
por vía materna
Muestra de tejido para extraer su ADN
La región de código de barras aislada y replicada mediante un proceso denominado amplificación por PCR y a continuación se secuencia
Base de Datos del Código de Barras de la Vida
Una biblioteca de referencia de códigos de barras de ADN abierta a científicos de todo el mundo para identificar rápidamente especies.
En comparación con otras fuentes animales (por ejemplo, ganado, ovejas, cabras o caballos) el número de especies es más grande, por lo que se acentúa la efectividad de la técnica
La identificación puede ir más allá del nivel de las especies, lo que permite la ubicación de variedades locales y por lo tanto, del origen del producto
Código de barras genético de mariscos, carne, plantas comestibles, productos lácteos y alimentos procesados
El “Barcode” está principalmente orientado a facilitar la identificación de especies, de manera que los taxónomos puedan dedicarse a resolver cuestiones científicas que les son propias como la delimitación y descripción de especies y taxones superiores y el análisis de las relaciones filogenéticas entre ellos.
Código de barras genético
(Usos)
Gracias
COI (Citocromo C Oxidasa I) es lo suficientemente corto como para ser secuenciado de forma rápida y barata, con el tiempo suficiente para identificar las variaciones entre especies.
Animales y muchos otros eucariotas, el gen mitocondrial COI
Plantas de la tierra, los genes del cloroplasto rbcL y matK.
Hongos, el espaciador interno transcrito (ITS).
ADNmt
ADN mitocondrial
ADN
Consta de aproximadamente 16500 pares de bases
La variabilidad en la región control .

El mtDNA contiene información de 38 genes:
2rRNA
22tRNA
13 genes estructurales
El entorno que rodea la mitocondria y el ADN mitocondrial está expuesto al daño oxidativo .
El ADN mitocondrial
El material no está protegido por histonas como lo está el ADN nuclear.
Los mecanismos de reparación de daños el ADN son poco eficientes en las mitocondrias.
Obtenemos como resultado que la tasa de mutación aumenta hasta ser 10 veces mayor que la del genoma nuclear
.
Full transcript