Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Transcriptoma

Aula na disciplina NG110, 2016/05/02
by

Felipe Rodrigues da Silva

on 8 June 2016

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Transcriptoma

EST – Expressed Sequence Tag
DNA
RNA
proteína
Dogma Central da Biologia
clonar
sequenciar
Felipe Rodrigues da Silva
Lab. de Bioinformática Aplicada - LBA
Lab. Multiusuário de Bioinformática - LMB
Embrapa Informática Agropecuária
felipe.silva@embrapa.br
X
Formato fastQ
@HS2_07083:2:1206:14255:166166#2
TGAGTAGATAAAATTTGACAACAATCTAAAGGCATTATTAAGTAATCAGAATCATTTTCAGTAGAACCAATCCCT
+
<BEHEID>JFJKKKLGKNJIJKJEHKELKMLFKLIIIMLLMHGJLIFFFILJCGLLCMIHJDLEKJH9E:LJH8B
@HS2_07083:2:1206:14255:166166#2
TCCAGGGTGGACAATAAGACCTTGTAGGCTGCAAGAGCCTGCCTCTGTCATTCTGGCCACAAAATCTGAGAAGGA
+
1LJIDNJ5MGL3KKDJFC+KHMHGIDKBG?BKCJ@96IFKBJIHGICIEGIEJJKJHILCJGKKIKHIFGFFED9
@HS2_07083:2:1207:20616:121747#2
CAAAATTCCAACTCAATTCTTCAACGAATTGGAAGGAGCAATTTGCAAATTTGTCTGGAATAACAAAAAACCTAG
+
7DEDEGFIKKHKIHJJLLGJHJKKKIJIKGKLIJLKJHMHLEMKJIJFGKKLDMKMIKKGDDIJLJMMMNJIJLJ
>HS2_07083:2:1206:14255:166166#2
TGAGTAGATAAAATTTGACAACAATCTAAAGGCATTATTAAGTAATCAGAATCATTTTCAGTAGAACCAATCCCT
>HS2_07083:2:1206:14255:166166#2
TCCAGGGTGGACAATAAGACCTTGTAGGCTGCAAGAGCCTGCCTCTGTCATTCTGGCCACAAAATCTGAGAAGGA
>HS2_07083:2:1207:20616:121747#2
CAAAATTCCAACTCAATTCTTCAACGAATTGGAAGGAGCAATTTGCAAATTTGTCTGGAATAACAAAAAACCTAG
Formato fasta
>HS2_07083:2:1206:14255:166166#2
9 9 9 6 6 6 4 6 4 4 4 4 4 7 9 8 8 7 4 4 9 9 7 7 4 0
4 19 20 27 32 29 20 15 4 0 4 7 7 9 19 23 24 18 10 10
6 9 15 17 31 28 27 13 12 8 8 9 12 19 31 48 44 46 46
46 46 46 35 35 35 35 35 35 46 46
>HS2_07083:2:1206:14255:166166#2
6 6 4 4 4 4 6 6 6 6 6 7 7 7 8 8 22 15 15 4 4 4 9 16
17 27 18 18 15 20 12 14 18 27 32 32 32 29 29 29 29
29 29 29 29 29 29 42 42 33 32 32 40 40 37 40 37 35
35 35
>HS2_07083:2:1207:20616:121747#2
4 4 4 6 4 7 7 7 7 10 10 8 4 0 4 8 8 13 23 19 12 9 8
19 13 15 14 20 19 28 21 16 16 23 29 40 40 56 56 56
51 51 46 46 46 46 51 51 51 51 51 56 51 51 51 39 39
39 39 39 39 40 40 46 46 51 51 51 40 40 40 39 35 35
35 39
arquivo .qual
Galaxy
ferramentas
dados
história
Dados
processados
cinza: na fila
amarelo:
processando
verde: pronto
no LMB
RNAseq,
sem saber programar
sem saber *nix
várias ferramentas na mesma interface
mesmo depois que se apagam os dados
pode salvar a sequência de passos (workflow)
,
etc.
guarda todos os passos (e parâmetros) das análise
felipe.silva@embrapa.br
Transcriptoma
Transcritos
Sequenciamento de
Próxima Geração - NGS
vs
Fonte: https://www.genome.gov/27541954/dna-sequencing-costs/
Full transcript