Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

resala

No description
by

Ahmed Khalil

on 27 September 2013

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of resala

` Genotype-phenotype association Genotype association STUDY OF PHENOTYPIC PRESENTATIONS OF EGYPTIAN CROHN'S DISEASE PATIENTS ACCORDING TO THEIR GENOTYPE PROFILE The predominant genotype at rs17234657 on PTGER4 gene was T/T both in cases and control
PTGER4 polymorphisms at rs17234657 on PTGER4 gene T/G was present in heterozygous form only.
No difference was found between cases and control as regards genotype and G risk allele at rs17234657 on PTGER4 gene.
There was no association also with G risk allele at rs17234657 on PTGER4 gene and Egyptian CD phenotype. From this study we can conclude the followings:
Genotyping of Egyptian CD patients differ from other ethnic groups.
Each of the 4 studied SNPs was in Hardy-Weinberg equilibrium (HWE) in the both cases and controls.
The predominant genotype at IL23R p.Arg381Gln was G/G both in cases and control.
The IL23R p.Arg381Gln variant was only present in heterozygous state G/A.
No significant differences were found in the presence of this genetic variant in CD patients and healthy controls.
Analysis of the allele and genotype frequencies at rs11209026 on the IL23R gene, showed no association between IL23R genotype variant and disease phenotype based on the Montreal classification Genotype-phenotype association at PTPN2 Genotype-phenotype association at IL12β Genotype-phenotype association at IL23R Crohn’s Disease Activity Index Surgical history Occupation Age of onset PTPN2 HOMOZYGOUS WILD TYPE T/T Comparison between two groups according to PTPN2 alleles Genotyping of PTPN2 in CD patients Genotyping of IL12β in CD patients 5p13.1 HOMOZYGOUS WILD TYPE T/T Genotyping of PTGER4 polymorphisms on 5p13.1 locus in CD patients Comparison between two groups according to IL23R alleles Genotyping of IL23R Arg381Gln variant in CD patients 5p13.1rs17234657 Interpretation
Extension
Annealing DNA amplification procedure PTPN2 encodes for proteins from the PTP family which are important regulators of T cell signal transduction.
Dysregulated PTPN2 leads to marked elevation of several proinflammatory cytokines including IFN-γ TNF-α and IL12. Protein Tyrosine Phosphatase IL12β receptor gene encodes the IL-12 p40 subunit shared by IL-12 and IL-23 cytokines.
IL-23/Th17 pathway is a key regulator of intestinal immune homeostasis and proinflammatory responses in defense to microbial infection Interleukin 12β Maintenance of intestinal homeostasis
Keep mucosal integrity,
Suppress the innate immunity,
Down regulate the proliferation and activation of CD4+ T cells.
In inflflamed tissues, prostaglandins has been proposed to favor Th17 responses. Role of the PGE2-EP4 Prostaglandin E Receptor 4 (PTGER4) Th17 cells, important mediator of the T-cell response in gut inflammation
IL-17 is a proinflammatory cytokine that enhances T-cell priming and stimulates fibroblasts, endothelial cells, macrophages, and epithelial cells to produce multiple pro-inflammatory mediators such as IL-1, IL-6, TNF, NOS2, metalloproteases, and chemokines.
IL-23 promotes development and expansion of a pathogenic IL-6/IL-17 producing memory-activated T-cell population that can trigger the inflammatory cascade leading to intestinal inflammation.
IL-12/IFN-γ and IL-23/IL-17 are parallel pathways involved in inflammatory response. IL23/IL17 axis  IL23 pathway/Th17 signalling
and IBD susceptibility genes. The IL-23R gene located on chromosome 1p31
encodes a subunit of the receptor for IL-23 and associates with IL-12RB1 to form the IL-23 receptor.
IL-23 promotes, along with TGF-β1 and IL-6, the expansion of the development of a new specific subset of T-helper cells lineage called Th17 cells, whose pivotal cytokine is proinflammatory IL-17 Interleukin 23 receptor (IL23R) Interleukin 23 receptor (IL23R) Including those related to
age of onset,
disease behavior,
disease location,
disease activity,
surgery,
dysplasia and cancer,
extraintestinal manifestations and
pharmacogenetics in CD . Genes related to prognosis Approximately 100 IBD susceptibility gene loci are currently known
71 in CD
47 in UC
at least 28 susceptibility loci are shared between CD and UC CD after GWAS Era Genome Wide Association studies (GWAS) 99·6% of the genome of any two unrelated individuals is identical.
Genetic variation can take the form of:
chromosomal rearrangements,
large-scale deletions or insertions,
small-scale deletions or insertions or
single base pair changes. HAPMAP PROJECT

HAPMAP PROJECT Knowing our differences Haploid genome is about 3.3 billion bp
3% consists of coding sequences
30 000–40 000 protein-coding genes. HUMAN GENOME PROJECT
13-year project Cracking our genetic code Gene structure Higher rates of CD among individuals of Caucasian and Jewish ethnicity.
Familial aggregation of CD.
Higher concordance rates of both twins developing CD in monozygotic compared with dizygotic twins. Evidence of genetic factors in CD PATHOGENESIS OF IBD More replication studies are required to clarify the role of new IBD loci in Egyptian population to define the exact composition of genes that affect our patients.
A bigger sample size is recommended to have more statistical power to confirm our results.
Replication studies should also include patients with UC the other subset of IBD to widen the genetic knowledge in Egyptian patients.
Therefore, independent result replication in different ethnic populations should be a key feature of genetic studies to elucidate and validate accurately disease-gene associations in each population RECOMMENDATIONS The predominant genotype at rs2542151 on PTPN2 gene was T/T both in cases and control.
PTPN2 polymorphism at rs2542151 on PTPN2 gene T/G was present in heterozygous form only.
No significant differences were found in the presence of PTPN2 polymorphism at rs2542151 on PTPN2 gene in CD patients and healthy controls.
The frequency of the risk allele G at rs2542151 on PTPN2 gene was similar in patients with CD and in the control group.
There was no association also with G risk allele at rs2542151 on PTPN2 gene and Egyptian CD phenotype. CONCLUSIONS The predominant genotype at rs1363670 of IL-12β gene was C/C both in cases and control.
The IL12β variant rs1363670 of IL-12β gene was present in both homozygous and heterozygous state.
The IL12β variant rs1363670 of IL-12β gene was equally present in CD patients and healthy controls with no significant differences.
The G allele frequency at rs1363670 of IL-12β gene was also equal in both patients and control group.
There was a significant association between genotype at rs1363670 of IL-12 gene and ileocolonic location and perianal disease. Genotype-phenotype association at 5p13.1 Diagnosis of CD patients according to Montreal classification Laboratory findings Clinical manifestations Smoking Residence Gender To study patient’s phenotypes PTPN2 HETEROZYGOUS WILD/ MUTANT TYPE T/G IL12β HOMOZYGOUS MUTANT TYPE G/G IL12β HETEROZYGOUS MUTANT /WILD TYPE G/C IL12β HOMOZYGOUS WILD TYPE C/C Comparison between two groups according to IL12β alleles 5p13.1 HETEROZYGOUS WILD /MUTANT TYPE T/G Comparison between two groups according to 5p13.1 alleles IL23R HETEROZYGOUS WILD /MUTANT TYPE G/A IL23R HOMOZYGOUS WILD TYPE G/G PTPN2 rs2542151 Interpretation IL12β rs1363670 Interpretation
Denaturation
Molecular Genotyping We conducted a Case-Control Study including:
Fifty CD patients diagnosed according clinical, endoscopic, radiological and histopathological criteria
Fifty healthy individuals with no history of IBD or immune-mediated diseases
Aim to evaluate the contribution of those confirmed IBD susceptibility loci mentioned above to the Egyptian population Similar to GWAS Protein Tyrosine Phosphatase, Non-Receptor Type 2 (PTPN2) Interleukin 12β receptor (IL12β) Including those related to
innate pattern recognition receptors,
epithelial barrier homeostasis,
molecular mimicry and autophagy and
genes related to lymphocyte differentiation Genes related to diagnosis The HapMap project chose a sample of 269 individuals and selected several million well-defined SNPs, genotyped the individuals for these SNPs, and published the results.
Haplotypes identified.
10 million SNPs --> roughly 500,000 tag SNPs HAPMAP PROJECT Results INTRON=NON CODING EXON=CODING Correlation of fecal calprotectin with activity indices Histopathological findings Distribution of the disease location of CD patients according to Montreal classification Endoscopic assessment IL23R rs11209026 Interpretation C/T polymorphism 10 million SNPs Single Nucleotide Polymorphisms (SNPs) account for most of the genetic variation of the human genome Radiological assessment Laboratory findings 100 Interleukin 23 receptor gene Prostaglandin E Receptor 4 Interleukin 12 receptor gene Protein Tyrosine Phosphatase,
Non-Receptor Type 2 gene By: Soad ElKady Indeterminate Colitis Manhattan Plot Sampling: whole blood was collected into EDTA tubes DNA Extraction Quantitative measurement of DNA By Nano Drop ND-1000 Spectrometer at 260 nanometer wave length DNA was extracted from whole blood using DNA purification kit (QIAamp DNA Mini Kit, Germany) Using the Light Cycler Roche SES-CD THANK YOU 1 2 3 4 Clinical assessment Histopathological examination Endoscopic assessment Radiological assessment Laboratory investigation A gene is the basic physical and functional unit of heredity. Genes, which are made up of DNA, act as instructions to make proteins.
In humans, genes vary in size from a few hundred DNA bases to more than 2 million bases. GWAS reported the following associations related to the studied gene variants ACAAAGCATTTCCTCCCAGTCACGTT[G/T]TCAAATAGCTTCTCATTCCCTGTAT SNP rs11209026 [Homo sapiens] and its gene location GATTGGGATATTTAACAGATCATTCC[A/G]AACTGGGTAGGTTTTTGCAGAATTT AACAAATGCTCATGTTTTAGCTAGAG[C/G]CAAACACAACAAAATGTCCAAAATG CACTTCGCCAATGCCTTGGTTCGGGC[G/T]CTTCCTGAGACTCTCATTTTCCTAA Activity Indices Correlations Correlation of BMI with activity indices 4 Newest susceptibility genes
Full transcript