Loading presentation...
Prezi is an interactive zooming presentation

Present Remotely

Send the link below via email or IM


Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.


Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks


Genetic basis of mutations

Drew Ising

on 25 February 2011

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Mutations

Mutations Chromosomal Base Base Chromosomal Basic types of base mutations... Point Frameshift Point A single base is replaced by a different base ... Only one amino acid is changed... Frameshift Addition or deletion of a nucleotide. ... All amino acids after mutation are changed... Silent Leaky Null Amino acid stays the same,
protein functions normally Amino acid is different, protein functions differently Protein does not and cannot function Amino acid is changed to STOP ARG ARG ARG GLN GLN STOP agtagatgatgatgatgctaggatgctagcta
acccgcgctcgagagagactctcgagaaa A B C D Usually have a much greater impact on the organism than a base mutation... WHY? Chromosomal Mutations Within a chrom. Aneuploidy Polyploidy D C B A C A B D D A C B Deletions Duplications Inversions Deviation from the normal
# of chromo. sets. Humans = 2 sets Change in chromo. # (not whole sets) ex: Trisomic person has 47 chromosomes, not 46 Result of NONDISJUNCTION error during meiosis A B C D C A B D NORMAL GENE & Monosomic person has 45. Human Monosomics In body (somatic) cells, monosomy is lethal.
Fetus will die before birth. ALWAYS People with Turner syndrome are missing a
2nd copy of the 23rd chromosome (XO). What would this person's gender be? Human Trisomics A person can survive to birth as a trisomic
of only 3 chromosomes. Trisomy 21 = Down's syndrome From: American Academy of Family Physicians Trisomy of 23rd chromosomes can result
in a very wide range of fertility, mental development and genders. ex: XXY, XYY, XXX What causes mutations? Mutagens Chemical Radiation Transposing Carcinogens Examples Aflatoxin B1 UV Light X-Rays Jumping genes What happens to proteins in a
BASE mutation?
Full transcript