Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Association of BRCA1 gene polymorphisms with breast cancer

No description
by

nurah almotiri

on 10 May 2014

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Association of BRCA1 gene polymorphisms with breast cancer

Association of BRCA1 gene polymorphism with breast cancer

By:
Ghadir Ali Alkarithi
Nurah Dakhelallah Almutairi

Outlines
Breast cancer.
Stages of BC.
Frequency of BC.
Risk factor of BC.
Genes associated with BC.
Materials and methoeds.
Results.
Conclusion.

Aim of project
To determine the frequency of the minor allele of rs1799950 SNP in BRCA1 gene and identify possible association with breast cancer using TaqMan SNP genotyping assays.

Breast cancer
Breast cancer is a tumor that starts in the cells of the breast and can invade to other tissue. It is found mostly in women.
Supervisor:
Prof. Mamdooh Gari
Dr. Ashraf Dallol


Stages of breast cancer
Stage 0 is carcinoma in situ, ductal carcinoma in situ (DCIS), abnormal cells are in the lining of a breast duct, but the abnormal cells have not invaded nearby breast tissue or spread outside the duct.

A:
The breast tumor is no more than 2 cm and cancer has not spread to the lymph nodes.

B:
The tumor is no more than 2 cm and cancer cells are found in lymph nodes.


Stage 0
Stage 1
Stages of breast cancer
The tumor is no more than 2 cm, and the cancer has spread to underarm lymph nodes.
Or the tumor is between 2 and 5 cm but the cancer hasn't spread to underarm lymph nodes.

Stage 11A
The tumor is between 2 and 5 cm, and the cancer has spread to underarm lymph nodes.
Or the tumor is larger than 5 cm, but the cancer hasn't spread to underarm lymph nodes.

Stage 11B
Stages of breast cancer
Stage 111
A:
The breast tumor is no more than 5 cm, and the cancer has spread to underarm lymph nodes or may have spread to lymph nodes near the breastbone.
B:
The tumor can be any size, and may have spread to up to 9 axillary lymph nodes or to lymph nodes near the breastbone.
C:
The breast cancer can be any size, and it has spread to more than 10 axillary lymph nodes or to lymph nodes near the breastbone. Or the cancer has spread to lymph nodes above or below the collarbone.
The tumor can be any size, and it has spread to other parts of the body.

Stage 1V
Worldwide cancer statistics
14.1 million adults in the world were diagnosed with cancer in 2012
Oncology Centre King Faisal Specialist Hospital and Research Centre, Kingdom of Saudi Arabia.

Frequency breast cancer in Saudi Arabia according to age
Stages of breast cancer in Saudi Arabia
Oncology Centre King Faisal Specialist Hospital and Research Centre, Kingdom of Saudi Arabia by year 2008-2012.
Risk factor for breast cancer
Female with family history is the major risk factor.
Advanced Age.
Unhealthy life style.
Diabetes.
lack of breast feeding.
Exposure to radiation.

Genes associated with breast cancer
BRCA1 gene
BRCA2 gene
ATM gene
TP53 gene
CDH1 gene
CHEK2 gene
BRCA1 and BRCA2
BRCA1

Location:
located on chromosome 17q21 .
encodes protein:
Consists of 1863 amino acids.
BRCA2

Location:
located on chromosome 13q12.3

encodes protein:
Consists of 3418 amino acids.
Function of BRCA1 and BRCA2
The BRCA1 and BRCA2 genes belong to
tumor suppressor genes.
the proteins produced from them help prevent cells from growing and dividing too rapidly or in an uncontrolled way.
Also, they are involved in many other functions including repairing double-strand breaks (DSBs) in DNA.

Role of BRCA1 and BRCA2 in DNA repair
BRCA1 and BRCA2 play a role in the cellular response to DNA damage, mediating between the sensors of damage to the effectors of repair.

The DNA double strand breaks can occur by natural radiation or other exposures and also occur when chromosome exchange genetic material (homologous recombination e.g.: crossing over).

When the DNA damage BRCA1 becomes hyperphosphorylated by different kinases one of them is ATM kinase.
The BRCA1 protein interacts with other tumor suppressor proteins such as RAD51 and BRCA2.
This complex of proteins are relocated to sites of replication forks marked by proliferating cell nuclear antigen (PCNA) then DNA will repair.


Role of BRCA1 and BRCA2 in DNA repair
Materials and methods
Sample collection and processing:

204 were diagnosed and treated for invasive ductal carcinoma at King Abdulaziz University Hospital, Jeddah, Saudi Arabia. And 120 as a control.

DNA Extraction
Genomic DNA was extracted using QIAGEN blood DNA extraction kit as per the instructions of the manufacturer.
Real time PCR
TaqMan probes are polynucleotides that have fluorescent reporter dyes attached to the 5' end and a quencher coupled to the 3' end.
These probes are designed to hybridize to an internal region of a PCR product.
In the unhybridized state, the proximity of the fluor and the quench molecules prevents the detection of fluorescent signal from the probe.

Real Time PCR
During PCR, when the polymerase replicates a template on which a TaqMan probe is bound, the 5'- nuclease activity of the polymerase cleaves the probe.
Real time PCR
This decouples the fluorescen dye thus, increasing the fluorescence in each cycle, proportional to the amount of probe cleavage.
TaqMan SNP Genotyping Assay
SNP genotyping assays are multiplexed assays with one probe targeting one allele is usually labeled with FAM dye and the other allele is targeted by another probe usually labeled with VIC.
Fluorescence detected from each particular probe is recorded and therefore the presence of that particular allele is determined.
The TaqMan assay targeting the rs1799950 SNP in BRCA1 IS:
AGGATTCTCTGAGCATGGCAGTTTC
[C/T]
GCTTATTCCATTCTTTTCTCTCACA.

TaqMan®SNP Genotyping Assay
Genotyping was carried out using TaqMan (Applied Biosystems) technology according to the manufactuer's instructions primers and probes were supplied directly by Applied Biosystems as Assay by Design. All assays were carried out in 96-well plates.
TaqMan®SNP Genotyping Assay
Results
Ongoing breast cancer research projects at the Center of Excellence in Genomic Medicine research have identified the presence of rs1799950 in one case of familial breast cancer.
This SNP is predicted to cause a damaging p.Gln356Arg mutation in BRCA1 thus reducing its capacity to repair DNA damage.
In order to understand the contribution of this SNP towards breast cancer susceptibility in our population we determined its frequency in a cohort of breast cancer patients as well as non-cancer controls.
Results
Allelic discrimination plot showing the homozygous states of the A allele (red) and the homozygous states of the G alleles (blue) in the breast cancer cohort.
Results
Results
Results
The rs1799950 SNP was in a highly significant Hardy-Weinberg disequilibrium in the patient group (X2=133.124) compared to the control group (X2=0.108).

The GG state of the rs1799950 SNP is significantly associated with breast cancer compared to the AA and AG states combined (p=0.0003, OR=22.79, CI=1.366-380.1)
Statistical analysis:
By using TaqMan SNP genotyping assays as molecular technology to identify possible association of SNP rs1799950 in BRCA1 gene with breast cancer.
The results show significant association with breast cancer.
It is likely to be useful in understanding and detecting increased susceptibility to the disease at an earlier stage and therefore improves our ability to prevent it.


Conclusion

we would like to thank our supervisor Prof. Mamdooh Gari and Dr. Ashraf Dallol for their continuous support us and we would like to thank the technical staff, especially Ms. Shylu Mathew and Mr. Ayman Bugis who helped us.
we want to thank the Center of Excellence in Genomic Medicine research at King Fahd Medical Research Center who give us a chance to perform this project.
finally, Thanks are given to sheikh Mohammed hussien Al-Amoudi Center of Excellence in breast cancer at KAU to providing us with leaflets to educate the community.
Acknowledgment
Thank you for Listening
Any question ?

frequency of Breast Cancer in Saudi Arabia
Results
A total of 6,922 female breast cancer cases were recorded in the Saudi Cancer Registry from 2001 to 2008.
References
National cancer institute http://www.cancer.gov/cancertopics/wyntk/breast/page6
Asif Mehmood,Ofelia B. Te, Joycylyn C. ,Asmara Khan ,(2012), Annual Report Prepared by the Staff of the Tumor Registry Research Unit, Oncology Centre King Faisal Specialist Hospital and Research Centre, Kingdom of Saudi Arabia.
Yoshida K, Miki Y (November 2004). "Role of BRCA1 and BRCA2 as regulators of DNA repair, transcription, and cell cycle in response to DNA damage
Goldgar DE1, Healey S, Dowty JG, Da Silva L, Chen X, Spurdle AB, Terry MB, Daly MJ, Buys SM, Southey MC, Andrulis I, John EM; BCFR; kConFab, Khanna KK, Hopper JL, Oefner PJ, Lakhani S, Chenevix-Trench G.( 2011 Jul 25) " Rare variants in the ATM gene and risk of breast cancer.
Alghamdi IG, Hussain II, Alghamdi MS, El-Sheemy MA, The incidence rate of female breast cancer in Saudi Arabia: an observational descriptive epidemiological analysis of data from Saudi Cancer Registry 2001-2008,oct 2013.
Hall JM, Lee MK, Newman B, et al.: Linkage of early-onset familial breast cancer to chromosome 17q21. Science 250 (4988): 1684-9, 1990
Narod SA, Feunteun J, Lynch HT, et al.: Familial breast-ovarian cancer locus on chromosome 17q12-q23. Lancet 338 (8759): 82-3, 1991.
Brose MS, Rebbeck TR, Calzone KA, et al.: Cancer risk estimates for BRCA1 mutation carriers identified in a risk evaluation program. J Natl Cancer Inst 94 (18): 1365-72, 2002.
Full transcript