Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

THE CASE OF THE DRUID DRACULA

an analysis of DNA fingerprinting
by

christine li

on 7 December 2013

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of THE CASE OF THE DRUID DRACULA

THE CASE OF THE DRUID DRACULA:

an analysis of DNA fingerprinting

The convicted: Mathew Hardman
The question is:

How did they determine who was responsible for such a bloodthirsty action? (haha)

Obviously, that's the forensics at work- using a method called DNA fingerprinting.
But how does that work?
-This is what we will be primarily focused on today.

what they found
The small, close-knit community of Llanfairpwll, on the Isle of Anglesey, was shocked by the murder of 90-year-old Mabel Leyshon at her home on 25 November 2001. Forensic Science Service (FSS) scientists were called by North Wales Police to examine the scene.
On their arrival they found that Mabel had suffered multiple stab wounds - the cause of her death - and several injuries following her death that included the removal of her heart. In addition they saw several carefully placed items including a candlestick and a pair of crossed pokers, which only served to emphasise the bizarre nature of the crime.
Retracing the offender’s steps, they discovered that the murderer had removed a slate from the back garden and thrown it through the lower glass pane in a rear door, gaining access to the house. Leaving his footwear marks on the broken glass and on the slate patio outside, scientists were able to create an artist’s impression of the shoes worn by the killer - Levi trainers - which had certain irregularities. In addition, a bloodstain matching the victim had been left by the offender on an interior windowsill on his way out. DNA analysis indicated a hint of a male component in the background, which over a period of time, was developed into a partial male profile.

AMELY Gene
This gene controls the biomineralization of tooth enamel. Because the length of the gene on the X chromosome differs from the length of the gene on the Y chromosome (X copy is missing some bases), and the gene is located on the Y chromosome (for males ) and second X chromosome (for females), police were able to identify the gender of the killer.
The victim:
Mabel Leyshon
Mabel Leyshon, a 90 year old woman, was stabbed to death at her bungalow 22 times with a kitchen knife, in Llanfairpwll on Anglesey, in November 25, 2001, while innocently watching television. Mathew Hardman - who was then high on cannabis and lived just a few yards away and had been Mrs Leyshon's paper boy - entered her home and mutilated her body before placing pokers at her feet in the shape of a cross. Her heart had been removed, wrapped in newspaper and placed in a saucepan on a silver platter next to her body. The prosecution said her killer drank her blood in a "macabre ritual" to satisfy his desire to become a vampire.


INVESTIGATORS
Emily Liu
Soyoung Lee
Krithika Kapussamy
Christine Li



THE CRIME SCENE
she's wearing a yorkie sweater, for crying out loud. How can anyone hurt her??
a bloody mouth and fangs
is not a good
look, dude.
this guy killed the nice
old lady in the yorkie sweater.
it'll look like this:
Laboratory examination of a saucepan into which the victim's blood had been collected revealed the presence of a lip mark on the edge. This macabre finding gave the police an insight into a motive that was ultimately linked with vampirism.
The crime was featured on BBC’s Crimewatch program in December 2001 and police received over 200 calls. Following up witness reports of a suspect who had attacked a German student, officers went to the home of 17-year-old Matthew Hardman. Officers found a pair of Levi shoes in his home. FSS scientists matched Hardman’s shoes to the footwear marks found at the scene. In spite of the results of offender profiling which suggested a much older offender, an FSS scientist convinced the officer leading the police investigation that the degree of match, although not conclusive, was in the circumstances highly significant.
On the basis of the footwear evidence, Hardman was arrested in January 2002. A knife was found in his coat pocket but there was no visible blood on the weapon. Hardman’s reference DNA sample was sent to the lab for profiling and a match with the profile from the windowsill was returned in 48 hours with a match probability of 1 in 1,000. Hardman was charged with murder based on the partial profile and the footwear match.
Using DNA Low Copy Number testing on the knife, the damaged handle revealed two sources of DNA, one matching Hardman and a partial profile matching the victim. In the meantime, further work on the partial profile from the windowsill improved the discrimination from one in 1,000 to one in five million and finally to one in 73 million.
UNLESS IF IT'S IAN SOMERHALDER
DNA
DNA is composed of 4 nitrogenous bases - Adenine, Guanine, Cytosine, and Thymine - attached to a deoxyribose sugar and 3 phosphate groups. It's in the shape of a double helix with a sugar-phosphate backbone and nitrogenous bases lining the inside, connected by hydrogen bonds. DNA forms complementary strands, with Adenine attached to Thymine and Guanine to Cytosine. The phosphates of the groups are attached at the 3rd and 5th carbons on the pentose sugar.
you mean Damon
DNA FINGERPRINTING: HOW DOES IT WORK??
DNA Replication
DNA has an antiparallel structure. As a result the strands travel in opposite directions, with one going 3' to 5' and the other going 5' to 3'. When DNA is replicated, helicase unwinds the double helix. This produces a replication fork. In this replication fork, DNA Polymerase adds nucleotides to one strand, while the other strand is a lagging strand because Polymerase can only add nucleotides starting on the 3' end and going to the 5' end. This lagging strand as a result is formed through bis and pieces of RNA Primers and in separate little pieces called Ozaki fragments until the fragments are joined together through DNA Ligase. Topoimerase finally cuts the helix and brings the two separate strands together. RNA primase synthesizes the RNA primers.
DNA Markers
PCR
PCR - Polymerase Chain Reaction - is a forensics technique that amplifies the amount of DNA present so that an adequate number can be used for testing. It has a high probability rate in identifying criminal suspects.
First, it selects a gene to be used and ONLY, ONLY IF the DNA sequences of BOTH strands at the beginning and end of the gene are known, can that gene be used. Using a DNA synthesizer machine, primers of 20 nucleotides of the beginning of the 1st strand and the end of the 2nd strand are created and extended. As a result, DNA is replicated artificially in a process that is similar to the natural organic one.
DNA markers are a gene sequence with a known location on a chromosome. In this case, STR, or Short Tandem Repeats, were used to identify the criminal. There are two types of markers: biochemical markers which detect the proteins and amino acids which are produced when the gene is expressed, and molecular markers which detect variations in the actual DNA- the differences in the nucleotides.
PCR
http://www.dnalc.org/resources/animations/pcr.html
DNA Fingerprinting
http://www.pbslearningmedia.org/asset/tdc02_int_creatednafp2/?utm_source=teachersdomain_redirect/asset/tdc02_int_creatednafp2/utm_medium=teachersdomain/asset/tdc02_int_creatednafp2/utm_campaign=td_redirects

DNA Testing
Gel electrophoresis is a technique used to separate pieces of DNA, in this case, by various sizes. However, it only determines the gender of the person.
Y: 5' CCCTAGGGTCTATAACGCCTAGTGTGTTGATTC 3'
X: 5' CCCTAGGGTCTAGTGTGTTGATTC 3'

Note that there are 2 Amelogenins, or the AMELY genes, on sample A while sample B has 1.
Because there are 2 AMELY genes on sample A, the DNA came from a male, or the suspect.
Sample B has 1 AMELY gene and thus, is from a female, or the victim.

Since gel electrophoresis only reveals the suspect's gender, another test must be conducted to provide solid evidence.
ST
R (S
ho
rt T
an
dem
Re
pea
ts
) An
al
ysi
s
STR are stretches of DNA that exists in everyone but with different number of repeats. For example, one person may have 5 repeats of the THO1 gene while their friend may have 9 repeats of it.
TPOX
CSF1PO
THO1
AMELY
*
*
*
*
How reliable is it?
The suspect, Matthew Hardman has 5 and 7 repeats for THO1.
Using the chart on the left, the fraction of those that have such repeats is (1/200)*(1/6), or 1/1200 of the human population.

The Evidence
The police found a blood stain and distinct tennis shoe footprints at the site of the crime scene.
They also discovered a knife and a pair of Levi tennis shoes in Hardman's possession. DNA testing revealed that Hardman's blood and Layshon's blood were on it. It also revealed that his DNA matched the blood stain in the crime scene. The shoeprints of his's shoes and the crime scene were similar. They also discovered magazines and internet sites accessed from his computer about how to become a vampire.
And so...
He was found guilty in August 2, 2002 and was sentenced to life in prison.
You guys might want to get rid of that ahahahaha//
played by:
Full transcript