Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

HLA typing using next generation sequencing - ASHG workshop

No description
by

Attila Berces

on 18 October 2013

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of HLA typing using next generation sequencing - ASHG workshop

Target specific solutions
Accurate and validated
Designed with diagnostics in mind
High-resolution HLA Typing of 1000 Genome data using Omixon Target
Attila Berces
Chairman, Omixon
Endre Major, Pierre-Antoine Gourraud, Szilveszter Juhos
Depending upon
which tool you use,
you can see pretty big differences between even the same genome called with different tools...
of HLA typing from whole genome/exome
depends on proper coverage width
Success
obtained
with relatively short read length
HLA genotypes represent
HLA is the most biomarker-rich
region of the human genome
Bio-IT World Magazine 2011
Mark Yandell
UCSF


Knome
Mass General Hospital - MiSeq
U. Southampton
GSK
Knome
Pabinger S et al. Brief Bioinform 2013; bib.bbs086
Omixon Target
Lack of suitable reference genome
High rate of polymorphism
Pseudogenes
Haplotype phasing
HLA
Accurate and validated NGS data analysis so that patients benefit from better diagnostics.
NGS analysis
2011
Medical impact
Lack of suitable reference genome
Pseudogenes
HLA-A
HLA-H
GGAC
C
GG
A
A
C
A
GGAC
G
GG
A
A
C
A
GGAC
C
GG
G
A
C
A
GGAC
G
GG
G
A
C
A
GGAC
C
GG
A
A
G
A
GGAC
G
GG
A
A
G
A
GGAC
C
GG
G
A
G
A
GGAC
G
GG
G
A
G
A

GGACCGGAACACACGGAAT
GGACGGGAACACACGGAAT
GGACCGGGACACACGGAAT
GGACGGGGACACACGGAAT
GGACCGGAAGACACGGAAT
GGACGGGAAGACACGGAAT
GGACCGGGAGACACGGAAT
GGACGGGGAGACACGGAAT
GGACCGGAACACACGGAAAGTGAAGGCCCACTCACAGACTG
GGACGGGAACACACGGAAAGTGAAGGCCCACTCACAGACTG
GGACCGGGACACACGGAAAGTGAAGGCCCACTCACAGACTG
GGACGGGGACACACGGAAAGTGAAGGCCCACTCACAGACTG
GGACCGGAAGACACGGAAAGTGAAGGCCCACTCACAGACTG
GGACGGGAAGACACGGAAAGTGAAGGCCCACTCACAGACTG
GGACCGGGAGACACGGAAAGTGAAGGCCCACTCACAGACTG
GGACGGGGAGACACGGAAAGTGAAGGCCCACTCACAGACTG
GGACCGGAACACACGGAATGTGAAGGCCCACTCACAGACTG
GGACGGGAACACACGGAATGTGAAGGCCCACTCACAGACTG
GGACCGGGACACACGGAATGTGAAGGCCCACTCACAGACTG
2013
GGACCGGAAGACACGGAATGTGAAGGCCCACTCACAGACTGGGACGGGAAGACACGGAATGTGAAGGCCCACTCACAGACTGGGACCGGGAGACACGGAATGTGAAGGCCCACTCACAGACTGGGACGGGGAGACACGGAATGTGAAGGCCCACTCACAGACTGGGACCGGAACACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTGGACGGGAACACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTGGACCGGGACACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTGGACGGGGACACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTGGACCGGAAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTGGACGGGAAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTGGACCGGGAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTGGACGGGGAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTGGACCGGAACACACGGAATGTGAAGGCCCACTCACAGACTCACCGAGTGGACGGGGAGACACGGAATGTGAAGGCCCACTCACAGACTGACCGAGTGGACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGGGACGGGAACACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGGGACCGGGACACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGGGACGGGGACACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGGGACCGGAAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGGGACGGGAAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGGGACCGGGAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGGGACGGGGAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGGGACCGGAACACACGGAATGTGAAGGCCCACTCACAGACTCACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGG
Solution:
Omixon Target
Validation
NIH
Tokai University
Whole
Genome
Exome
PCR
Results
Targeted amplicon
HLA-A,B, C, DRB1
concordance
100%
Raindance HLA-seq Research Panel
HapMap samples
96%
unambiguous
concordance
88%
1000 genome data
Whole Genome data
designed for population genetics study
4-5-fold coverage
76 bp read length
Exome data
20-fold coverage
allele drop-outs
Whole Genome
2-9x coverage
unambiguous
all mismatches, ambiguities are explained by missing coverage
75%
89%
concordance
Germline mutations
High rate of polymorphism
Phasing problem
Phasing problem in NGS
Visit poster O19
% Concordance
Whole genome sequencing
86.1
Exome sequencing
93.5
State of the art
...failure to obtain a concordant result was because of a lack of recognition of the appropriate manual edit to perform...
ASHI accreditation
EFI accreditaiton
Public 1kG data
UCSF collaboration
Gene #of samples Concordance common
HLA-A 614 84.6 95.1
HLA-B 637 93.4 94.9
HLA-C 645 90.5 95.5
HLA-DRB1 777 89.6 90.3
HLA-DQB1 817 86.5 86.4
1 SNP mismatch
1100 death
$200M
Human genome 3.000.000.000 bp
sequence reads 250 bp
The HLA
challenge
Motivation
500,000 medical exomes in 2012
genomic medicine
challenge with 7000+ validation data sets
G
Goal of the webinar
-review basic challenges
-introduce new features of Omixon Target
-how new features help assay development

Questions and Answers
Full transcript