Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

DNA

No description
by

Hyemi Kim

on 8 October 2014

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of DNA

20133296 Hyemi Kim
Molecular Biology
8. Transcription
9. Translation
10. DNA damage & repair
11. PCR
DNA
genes are
expressed by
making RNA
2. Pyrimidine metabolism
3. Purine metabolism
4. Structure of DNA
5. Organisation of DNA
6. Central dogma
7. Replication
1. Cell cycle
Exception of Central dogma
ribose-5-phosphate
PRPP
orotate
UMP
UTP
CDP
CTP
dCDP
Purine, Pyrimidine
Major E carrier
dTMP
dTTP
dCTP
ribose-5-phosphate
PRPP
IMP
GDP
GTP
ATP
dGTP
dATP
ADP
AMP
GMP
Uric acid
T
H
E
E
N
D
T
H
X
Presented by Hyemi Kim
Human Genome project : $3billion took ~10 yrs



Wobble hypothesis
64 codon>20 A.A
Prokaryote
AUGCAUGGGAUAUAGGCCUUAG
AUGCAUG/GGA/UAU/AGG/CCU/UAG/
AUG/CAU/GGG/AUA/UAG/GCCUUAG
5' cap _methyl
3' poly A
Intron
Exon
Genome
Gene
Stephen Quake's group : $50,000 at 2009
James Watson : $2million at 2007
Celera Genomics : $300million took ~2yrs at 2001
Full transcript