Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

DNA Typing

No description
by

Zoe Swindell

on 3 March 2011

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of DNA Typing

DNA Typing The chemical structure of DNA is the same in everyone DNA Fingerprinting
DNA Profiling What is DNA Typing? using the sequences of base pairs, you could identify a single person the order of the base pairs is different but there are millions of base pairs... BUT AATGCTC V.S. GCAACCT This is one person... and this is a different person luckily, there are repeating patterns in a sequence AATGCTCAATGCTCAATGCTCAATGCTC these repeating patterns help to identify if two sets of DNA are from the same person to see if two people are related or not scientists use a small number of DNA sequences that vary among individuals so that it is easier to get a probability match OR Zoe Swindell How is it Done? Southern Blot Making a Radioactive Probe Creating a Hybridization Reaction VNTRs 1. Isolate the DNA this can be done in two ways: A) using a detergent to wash the extra material from the DNA B) apply a large amount of pressure to "squeeze" out the DNA 2. Cut the DNA into several pieces of different sizes. 3. Sort the pieces by size This process is called GEL ELECTROPHORESIS A) The DNA is poured into a gel B) An electrical charge is zapped into the gel. The negative charge at the top and the positive charge at the bottom. C) DNA has a slight negative charge so the pieces will go to the bottom. D) The smaller pieces are able to move more quickly so they got to the very bottom. E) The DNA is now separated by size with the smaller pieces at the bottom. 4. Denatur the DNA so all of the DNA is single stranded this can be done in two ways: A) heating the DNA B) chemically treating the DNA 5. Blot the DNA The gel with the DNA is applied to a sheet of nitrocellulose paper The paper with th DNA gel on it is then baked to attach the DNA to the sheet permanently To analyze a Southern Blot 1. A raidoactive genetic probe is used in a hybridization reaction with the DNA. 2. After the probe has bonded with the denatured DNA, an X-ray is taken. 3. Only the places where the probe has bonded will show up (in red) now you can identify in a person's DNA a particular genetic pattern that will show if the two sets of DNA match or not 1. Get some
DNA polymerase.
Put DNA that is to be radioactive into a tube. 2. Introduce horizontal breaks, or nicks, along the strand of DNA. Add individual nucleotides to the nicks. One of the nucleotides is a radioactive *C. 3. add the DNA polymerase to the tube 4. The DNA polymerase will repair the nicks in the DNA. It destroys all bonds in front of it and places the new nucleotides behind it. When a G is read, a radioactive *C is placed in the new strand. Thus the nicked strand is made radioactive. 5. The DNA is heated, splitting the two strands apart. The radioactive DNA is now a probe. Hybridization- the coming together of two genetic sequences there are hydrogen bonds between the base pairs 1. DNA is denatured 2. A single-stranded radioactive probe is used to see if the DNA contains a sequence that is similar to the sequence on the probe. Variable Number Tandem Repeats Exons- contain genetic information that informes an organism's development every strand of DNA has... Introns- contain repeated sequenses of base pairs these sequenses are VNTRs To see if a person has a certain VNTR, a Southern Blot is preformed. The Southern Blot is probed through a hybridization reaction. The the resulting pattern is called a DNA Fingerprint. a person's VNTRs come from genetic information that was given by their parents you can NOT have a VNTR that neither of your parents have!!! Using DNA as Evidence Blood Hair Skin Cells Saliva Sperm all of these are some of the things that can be used to identify a criminal 1986: Richard Buckland was exonerated. This was the first use of DNA Typing in a criminal investigation 1987: Colin Pitchfork was the first criminal to be caught by using DNA Typing 1987: DNA Typing was used in criminal court for the first time 1989: Gary Dotson was the first person whose conviction was overturned by using DNA evidence 1994: the science of DNA Typing was made famous when it was used to link O.J. Simpson to a double murder 1994: Royal Canadian Mounted Police detectives tested hairs from a cat and used the DNA to link a man to the murder of his wife. This was the first time non-human DNA was used to identify a criminal 1998: Dr. Richard J. Schmidt was convicted of attempted second-degree murder.
There was a link between the viral DNA of HIV that he had injected in his girlfriend.
This was the first time viral DNA Fingerprinting was used in a criminal investigation 2003: Jeffrey Gafoor was convicted of the 1988 murder of Lynette White. Evidence from 12-years earlier was re-examined and resulted in a match with his nephew. This is the first known example of DNA from a related individual being used to identify a criminal, via "familial searching". Cases between A and T there are two bonds between C and G there are three bonds Work Cited Brinton, Kate. "Basics of DNA Fingerprinting." Mac OS X Server. May 1994. Web. 20 Feb. 2011. <http://protist.biology.washington.edu/fingerprint/dnaintro.html>. "DNA Forensics." Oak Ridge National Laboratory. 16 June 2009. Web. 20 Feb. 2011. <http://www.ornl.gov/sci/techresources/Human_Genome/elsi/forensics.shtml>. Chavis, Jason C. "What Is Forensic DNA Typing?" WiseGEEK: Clear Answers for Common Questions. Ed. Bronwyn Harris. 2011. Web. 21 Feb. 2011. <http://www.wisegeek.com/what-is-forensic-dna-typing.htm>.
Full transcript