Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Beckwith-Wiedemann Syndrome

No description
by

Carlos Jimenez

on 11 May 2014

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Beckwith-Wiedemann Syndrome

Conventional karyotype = analyze chromosomal anomalies (1%).

MLPA = analyze alterations limited to Domain 1 (5%), limited to Domain 2 (50%), and UPDs (20%).
Molecular Diagnosis of
Beckwith-Wiedemann Syndrome
Graupera de la Torre, Víctor
Jiménez Jiménez, Carlos

Molecular Diagnosis of
Beckwith-Wiedemann Syndrome
Molecular Diagnosis of
Beckwith-Wiedemann Syndrome
1- Introduction
Clinical Features
Pediatric overgrowth disorder.

Incidence: 1 of each 13.700.
Originally named by John Bruce Beckwith and Rudolf Wiedemann
EMG
7,5% (4%- 21%) risk of developing an early tumor (Wilms tumor and Hepatoblastoma)

First 8 years of life (higher risk at first 5 years)
Macrosomia
Macroglossia
Omphalocele
Cardiomegaly
. . .
Visceromegaly
Umbilical hernia
Hemihyperplasia
Kidney abnormalities
Cleft palate
Neonatal hypoglycemia
Anterior ear creases
Molecular Features
Domain 1 (telomeric) - [5%]

IGF2 = growth factor

H19 = tumor supressor (growth repressor)
Domain 2 (centromeric) - [50%]

KCNQ1 = potassium channel

CDKN1C = negative regulator of cell proliferation

KCNQ1OT1 = lncRNA antisense to KCNQ1
Uniparental Disomy - [20%]

Mosaicism (post-zigotic error)
CDKN1C mutations - [10%]

If family history - [40%]
85% known alteration.

15% idiopathic.
NLRP2 (cr. 19).
PLAG1 (cr. 6).
GNAS (cr. 20).
Domain 1 & UPDs = risk of early tumor of 25%, including Wilms tumor.

Domain 2 = risk of early tumor of 5%, but not Wilms tumor. Associated with ARTs.
Chromosomal anomalies - [1%]
11p15.5
Heterogeneous etiology
Numerous techniques
Molecular Diagnosis of
Beckwith-Wiedemann Syndrome
3- Practical case
Dr. Vicenç Català (UAB)

Dra. Esther Geán (Sant Joan de Déu Hospital)
1. Methylation studies
2. UPD analysis
3. CDKN1C mutations
4. Classical Cytogenetics
Thank you very much for your collaboration!
Macrosomia
Macroglossia
Omphalocele
Cardiomegaly
. . .
Visceromegaly
Umbilical hernia
Hemihyperplasia
Kidney abnormalities
Cleft palate
Neonatal hypoglycemia
Anterior ear creases
A four years old kid is hospitalized due to a Wilms tumor. There was no family history and he resulted from ARTs (ICSI).

Phenotype: macroglossia and ear creases

Medical history: gigantism and umbilical hernia at birth, and hypoglicemia two weeks after birth.
Methylation
analysis
Southern blot
Beckwith-wiedemann
Let's do some molecular analysis!
Methylation sensitive restriction enzymes: NotI and SmaI

Domain 1: -15 to H19
Domain 2: promoter of KCNQ10T1
H19:

methylated: 1.8kb band
ummethylated: 1kb band
KCNQ1OT1:

methylated: 6kb band
ummethylated: 4.2kb band
Quantitative
MS-PCR
Bisulfite treatment (C T)
TaqMan probes (5' labeled)
Two reactions (each one with U-probe and M-probe):


Domain 1: CTCF bnding site 6, 2kb upstream H19

CTCF6M AAGTGGTCGCGCGGCGGTAGTGTA (FAM)
CTCF6U TGGAAGTGGTTGTGTGGTGGTAGTGTAGG (HEX)

Domain 2: KCNQ10T1 promoter (-6 to -34 to).

Lit1-M CGGCGGGGGTAGTCGGAGCG (FAM)
Lit1-U TGGTGGGGGTAGTTGGAGTGTTGTTGTAG (HEX)

What about the MLPA? What do you believe that was the result?

a) Gain of methylation (Domain 1)

b) Loss of methylation (Domain 2)

c) Alteration on both domains

d) No alterations found: look for CDKN1C mutations
What about the MLPA? What do you believe that was the result?

b) Loss of methylation (Domain 2)

Result concordant with ARTs but not with Wilms tumor...

Can we explain the reason why this kid had a Wilms tumor despite not having Domain 1 altered?
MS-MLPA
Specific probe pairs for
HhaI sites
.
HhaI:
methylation sensitive
restriction enzyme.

Methylated:

HhaI can't digest

Ligation

Amplification

Unmethylated:

HhaI digests

No ligation

No amplification

What about the MLPA? What do you believe that was the result?

b) Loss of methylation (Domain 2)

Can we explain the reason why this kid had a Wilms tumor despite not having Domain 1 altered?

Accumulation of independent symptoms!
Wilms tumor was not related to Beckwith-wiedemann syndrome, so the kid is being watched due to the high risk of developing another early tumor.
Molecular Diagnosis of
Beckwith-Wiedemann Syndrome
Thank you for your attention!
If later on you have a question, ask it on or on and we will answer it!
Bibliography
Webgraphy
NCBI (gene reviews): http://www.ncbi.nlm.nih.gov/books/NBK1394/

OMIM

Orphanet

Intergenetics
Choufani, S. et al.
- Beckwith-wiedemann syndrome
- Am J Med Genet Part C 154C:343–354.

Coffee, B. et al.
- Molecular diagnosis of Beckwith-Wiedemann syndrome using quantitative MS-PCR
- Genet Med 2006:8(10):628–634.

Baskin, B. et al.
- High frequency of CNVs in the 11p15 region in patients with BWS
- Hum Genet (2014) 133:321–330

Keren, B. et al.
- SNP arrays in Beckwith-Wiedemann syndrome: An improved diagnostic strategy
- European Journal of Medical Genetics 56 (2013) 546-550

Gaston, V. et al.
- Analysis of the methylation of KCNQ1OT and H19 genes for the diagnosis and prognosis of BWS
- European Journal of Human Genetics (2001) 9, 409 - 418

Romanelli, V. et al.
- CDKN1C Analysis in BWS patients: Genotype-Phenotype, Correlations, Novel mutations, and Polymorphisms
- Am J Med Genet Part A 152A:1390–1397

Begemann, M. et al.
- Use of multilocus methylation-specific single nucleotide primer extension (MS-SNuPE) technology in diagnostic testing for human imprinted loci
- Epigenetics 7:5, 473-481; May 2012
MS-MLPA + conventional MLPA


methylation analysis + CNVs
+HhaI
-HhaI
CNVs
Methylation
Other techniques
MS-SNuPE: similar to SNaPshot (microsequencing)

aCGH: CNVs
UPD
studies
CDKN1C
mutations
both IC
altered
any
altered IC
GOM IC1
LOM IC2

Diagnosis!
Marker-based studies
STR analysis, MLPA, etc

SNP array
Sequence analysis

Exons 2 & 3

Sequencing techniques
Cytogenetics
Karyotype
FISH
Mosaicism
Partial
4- Genetic counseling
No family history
(85%)
GOM/LOM
Recurrency risk
(siblings & offspring)
low!
Paternal UPD
Recurrency risk
(siblings & offspring)
low!
Microdeletion/microduplication
Siblings:

if CNVs are detected in parents 50%

Offspring:

50%; BWS or RSS
Maternal
microdel.
Paternal
microdupl.
BWS
BWS
RSS
RSS
50%
50%
50%
50%
CDKN1C mutations
Unaffected carrier parents?!



Studies
Family history
(15%)
40%: CDKN1C mutations; AD
Maternal: 50%

Paternal: poor data

Neither parent: low risk
(germline mosaicism?)
Chromosomal abnormalities
(1%)
De novo

Inherited:
generally 50% risk of transmission

unbalanced translocations either maternal or paternal
Prevention
Prenatal diagnosis

Genetic Preimplantation Diagnosis?
CAUTION
ARTs (FIV-ICSI) associated with increased risk of BWS
Graupera de la Torre, Víctor
Jiménez Jiménez, Carlos
2- Molecular Diagnosis
Molecular Diagnosis of
Beckwith-Wiedemann Syndrome
Exomphalos (Omphalocele)


Macroglossia (Long tong)


Gigantism (Macrosomia)
1) Diagnosis confirmation
2) Prognosis
3) Genetic counsealing
Full transcript