Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Expresión genética

¿Cómo es leída la información de los genes? ¿Para qué sirve? Aquí un ejemplo usndo a la insulina de pretexto. ¡Espero que les guste!
by

Felipe Alcantara-Sanchez

on 2 December 2016

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Expresión genética

>gi|224589802:c2182653-2180793 Homo sapiens chromosome 11, GRCh37.p13 Primary Assembly
TAATGACCCGCTGGTCCTGAGGAAGAGGTGCTGACGACCAAGGAGATCTTCCCACAGACCCAGCACCAGG
GAAATGGTCCGGAAATTGCAGCCTCAGCCCCCAGCCATCTGCCGACCCCCCCACCCCAGGCCCTAATGGG
CCAGGCGGCAGGGGTTGAGAGGTAGGGGAGATGGGCTCTGAGACTATAAAGCCAGCGGGGGCCCAGCAGC
CCTCAGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTC
AGGTGGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGG
CTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCC
CTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCT
GCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTG
GAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGG
ACCTGCAGGGTGAGCCAACTGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCTC
CCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAA
GAAGTTCTCTTGGTCACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGAC
GGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAAA
CAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAG
TCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACACCCCATCACGCCCGG
AGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGGCCTCACGGCAGCTCCATAGTCA
GGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTG
TGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACACCCAGT
GTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGC
GGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAAC
CTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTG
CAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCT
CCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGCAGCCCCACACCCGCCGCCTCCTG
CACCGAGAGAGATGGAATAAAGCCCTTGAACCAGCCCTGCTGTGCCGTCTGTGTGTCTTGGGGGCCCTGG
GCCAAGCCCCACTTCCCGGCACTGTTGTGAGCCCCTCCCAGCTCTCTCCACGCTCTCTGGGTGCCCACAG
GTGCCAACGCCGGCCAGGCCCAGCATGCAGTGGCTCTCCCCAAAGCGGCCATGCCTGTCGGCTGCCTGCT
GCCCCCACCCTGTGGCTCAGGGTCCAGTATGGGAGCTGCGG
Insulina humana y porcina
¿Cómo se llega del gen a la proteína?
Se requiere de dos procesos coordinados para la expresión del gen: la
transcripción
del gen y su
traducción
Expresión genética de la insulina
El Dr. Frederick Banting
Órgano encargado de secretar enzimas digestivas y secretarlas al tubo digestivo (función
exocrina
) ; así como las hormonas
insulina
y
glucagón
, que viajan por el torrente circulatorio (función
endocrina
)
El páncreas:glándula del sistema digestivo
En el páncreas, se pueden identificar varios tipos de células y tejidos.
1.
Células acinares
, exocrinas.
2.
Ínsula de Langerhans
; las células beta secretan
insulina
.
Ínsulas de Langerhans
http://www.histol.chuvashia.com/atlas-en/digestive-03-en.htm

Imagen de microscopía electrónica de transmisión de una célula beta normal (Lacey & Hartroft, 1959)
En los brazos largos (p) del par 11 se encuentra el locus del gen INS, que contiene la información para la síntesis de insulina.
Cariotipo humano: el conjunto de cromosomas pareados y alineados
El material genético
...
Célula
Cromosoma
Histona
La insulina es una proteína pequeña que es exportada de las céluals beta de Langerhans hacia el torrente sanguíneo.
Gen INS
Gen
: Es una secuencia de nucleótidos que se encuentra en el ADN.
Es información química que tiene que ser interpretada para tener sentido
TRANSCRIPCIÓN:
Traducción y procesamiento de la proteína precursora
Luego de la síntesis de proteína por el
ribosoma
, la proteína es procesada dentro de las vesículas, pasando por el retículo endoplásmico y el aparato de Golgi.
El resultado, es que el péptido original es cortado en tres piezas, una es eliminada y con las otras dos (A y B) se arma la insulina madura.
¡Listo!
La proteína madura es exportada por medio de vesículas de secreción hacia los vasos sanguíneos, hasta alcanzar sus tejidos diana y regular los niveles de glucosa en la sangre.
Del gen a la proteína madura
Síntesis de una molécula intermediaria (el ARN mensajero) que lleva la información del núcleo al citoplasma, donde será interpretada
Síntesis de ARN dependiente de ADN catalizada por las enzimas ARN polimerasas.
El producto es un ARN mensajero (mRNA) que contiene información para la síntesis de proteínas, o bien alguna molécula de ARN reguladora (tRNA, rRNA, snRNA, miRNA, etc.)
Gen INS: información en el núcleo celular para fabricar insulina
Full transcript