Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

La prevalencia de Listeria monocytogenes en la carne de cerd

No description
by

CIRIS ANGELICA MENA PALACIOS

on 8 October 2013

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of La prevalencia de Listeria monocytogenes en la carne de cerd

LA PREVALENCIA DE Listeria monocytogenes EN LA CARNE DE CERDO Y OTROS PRODUCTOS PROCESAR DE LA INDUSTRIA PORCINA COLOMBIANA
Introducción
L. monocytogenes ha causado varios brotes alimentarios, especialmente a través de un grupo de productos listos para el consumo de alimentos, donde la carne y los productos lácteos son los más afectados.

Características generalesListeria monocytogenes
MATERIALES Y MÉTODOS
Resultados
La identificación molecular de L. monocytogenes por Multiplex-PCR.
DISCUSIÓN
CONCLUSIÓN
Se encontró L. monocytogenes en diferentes productos analizados, con especial interés en jamón y embutidos, ya que ambos se consumen sin tratamiento térmico previo.
OBJETIVO
Determinar la prevalencia de L. monocytogenes en las canales de cerdo, carne de cerdo y productos elaborados a base de carne de cerdo de la industria porcina nacional

Selección de plantas de procesamiento de cerdo

Carne de cerdo de plantas de beneficio
Decreto 1500
Fedegan
23 plantas

Tamaño de la muestra
Selección de carne de cerdo

Mercados que venden
Áreas de la industria de carne de cerdo
472 muestras – 58 lotes

Selección de los derivados cárnicos
Materia prima
Alto consumo de productos procesados
481 muestras salchichas, jamón, chorizos.

La toma de muestras

Recolección por la norma ISO 17604
Punto de venta mercado 500g
Punto de venta mercado 250 - 500g

Análisis microbiológico.

Lab Universidad Javeriana
Procesamiento descrito por USDA
ISO11290-1
25g – homogenizo 225ml caldo frase – incubo a 30°c, 48 - -suspensión se incubo a 35° a 40h - se aislo en ottaviai agosti-agar y palcam colonias purificadas en TSAYE

Desarrollo de Banco de Células madre (MCB)

Se inocuo colonias aisladas en 20ml caldo BHI
Se mezclo con glicerol
Almaceno a -20°C

Extracción de ADN genómico (gDNA)

ADN genomico
Celulas Cultivadas
"kit de purificación de ADN genómico Wizard"
Determinacion de pureza

Identificación molecular por PCR múltiple
L. monocytogenes
Los cebadores usados ​​para la reacción de PCR fueron L1 (CTCCATAAAGGTGACCCT) / U1 (CAGCMGCCGCGGTAA TWC) y LF (CAAACGTTAACAACGCAGTA) / LR (TCCAGAGTGATCGATGTTAA)
1.) Tamaño de la población [1.927.273 cerdos sacrificados / año],
2.) Prevalencia esperada 50%
3.) Diferencia máxima esperada 5%
4.) Error tipo I [1%]
5.) Tamaño de la muestra 566
6.) Número de plantas para el muestreo 23.
PREVALENCIA DE L. Monocytogenes en CANALES DE CERDO, CORTES DE CARNE Y PRODUCTOS PROCESADOS
CORTES DE CANE
PRODUCTOS PROCESADOS
CANALES DE PLANTAS DE PROCESAMIENTO
BIBLIOGRAFÍA

GAMBOA-MARIN, Andrea et al. Prevalence of Listeria monocytogenes in pork-meat and other processed products from the Colombian swine industry. Rev.MVZ Cordoba [online]. 2012, vol.17, n.1, pp. 2827-2833. ISSN 0122-0268.
CIRIS ANGELICA MENA PALACIOS
INGENIERÍA DE ALIMENTOS
PROCESOS CÁRNICOS
UNIVERSIDAD DE LA AMAZONIA
Andrea Gamboa B, Sonia Buitrago M.
Pontificia Universidad Javeriana
Aceptado: Diciembre de 2011.
Rev.MVZ Córdoba
GRACIAS
Full transcript