Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Der Programmierte Zelltod - Die Geschichte von Leben und Tod

GFS über den Vorgang des programmierten Zelltods (Apoptose) und daraus entstehende Folgen für Organismen (Altern und Tod)
by

Kai Clemens

on 17 December 2012

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Der Programmierte Zelltod - Die Geschichte von Leben und Tod

Was ist das? gezielter Tod körpereigener Zellen
dient der Selbstregulation des Organismus
entfernt für den Körper unnötige oder schädliche Zellen
wird durch das Protein Caspase ausgelöst Telomer gr. télos: "Ende" + gr. méros: "Teil"
repetitive DNA-Sequenz am Chromosomenende (ca. 10 kbp)
ausschlaggebend für Chromosomenstabilität
begrenzt Replikationsfähigkeit [ TTAGGG ] Der Programmierte Zelltod Eine Geschichte von Leben & Tod [TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG] Websites
http://www.pnas.org/content/early/2012/11/09/1209714109 (15.11.12)
http://1.bp.blogspot.com/-NCfeFcs-cy8/T6DVpd6XLwI/AAAAAAAAAI8/iJduAUTY9vA/s1600/telomer.jpg (24.11.12)
http://de.wikipedia.org/wiki/Telomer (24.11.12)
http://de.wikipedia.org/wiki/Apoptose (24.11.12)
http://de.wikipedia.org/wiki/Programmierter_Zelltod (24.11.12)
http://de.wikipedia.org/wiki/Telomerase (24.11.12) Inhalt Was ist der "Programmierte Zelltod"?
Wann tritt er ein?
Die Apoptose
Die Nekrose
Zukunftsvision: Den Tod austricksen?
Quellen Wann tritt sie ein? Erreichen der Hayflick-Grenze (< 4 kbp)
Metamorphose/Degeneration
Verhornung
Mutation/Missbildung
Immunabwehr (T-Killerzellen)
holokrine Sekretion
Selektion
Regulation Apoptose gr. apoptein: "abfallen"
1842 von Carl Vogt beim Studium von Kaulquappen entdeckt
1972 Prägung des Begriffs "Apoptose" durch J. Kerr, A. Wyllie und A. Currie Quellen extrinsischer Weg Bindung von Apoptose induzierenden Liganden (z.B. Zytokinen) an Rezeptoren der Zellmembran
Second Messenger: Bildung von Caspasen
Caspase 8 leitet Caspase-Kaskade ein intrinsischer Weg Auslösung von pro-Apoptose-Faktoren im Zellinneren
Bildung von Procaspase 9
Ausschüttung von Caspase 7, 8 und 9 leitet Caspase-Kaskade ein Caspase-Kaskade Ausschüttung der Effektor-Caspasen 3, 6 und 7
zersetzen Zytoskelett und lösen Ausschüttung weiterer Enzyme aus (z.B. DNAse)
Zelle schnürt sich in Vesikel ab und wird von Fresszellen phagozytiert Nekrose gr. nékrosis: "das Töten"
Zelltod durch äußere Einflüsse (mechanische Belastung, Temperatur, Pathogene, Gift, Strahlung, Wasser-, Sauerstoff- oder Nährstoffmangel)
führt zur Ausschüttung des Zellinhalts in die Extrazellulare
löst Entzündungsreaktion aus Den Tod austricksen? Genotyp des FoxO3-Gens in Süßwasserpolypen (Hydridae) und alten Menschen (> 100 Jahre)
ermöglicht Umwandlung ausdifferenzierter somatischer Zellen in totipotente Stammzellen Umwandlung somatischer Zellen in pluripotente Stammzellen mithilfe von Transkriptionsfakoren FoxO3 Induzierte pluripotente Stammzellen Anbau von Nucleotiden an Telomere durch Enzym Telomerase
Telomerase nur aktiv in Einzellern, embryonalen Stammzellen, Keimzellen und Tumorzellen Reverse Transkriptase Vielen Dank für Eure Aufmerksamkeit! Noch Fragen?
Full transcript