Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Multiple Start Codons

Can the ribosome recognize multiple start codons?
by

Hannah Jepsen-Burger

on 18 October 2012

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Multiple Start Codons

GACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTTCTAGAAAAAAAATAAGGAGGTAA Promoter Region Ribsosome Binding Site RBS binds the ribosome to begin translation of mRNA
varying strength controls amount of expression ATG a sequence (typically ATG) that initiates and defines an Open Reading Frame (ORF) START
CODON GCG AGC T AT G AA GAT CTT ATG begins initation of RED FLUORESCENT PROTEIN (RFP) ALTERNATE START CODON possible secondary point of translation initiation ATG begins translation of sfGFP sfGFP RFP sfGFP open reading frame (+1) RFP open reading frame (0) N sfGFP RFP ATGNATG Symbolic Model Assembly design construct
anneal 4 oligos together with dRBS1 vector
transform and plate
select colonies and sequence CONSTRUCT: plasmid that performs the desired function Determine primers that will isolate that DNA from other plasmids Piece together parts of DNA Edit sequences in ApE OLIGOS (oligonucleotides)

short sequences of DNA used as primers, constructs pieces, etc.
usually ssDNA ANNEAL to allow complementary basepairs to bond together VECTOR backbone of the construct Expected Results measure fluorescence per OD600 in TECANM1000
normalize data with constant K
cell expresses both RFP and sfGFP due to start codon slippage
observed colonies reflect strength of RBS usually contains origin of replication and antibiotic resistance TRANSFORM to force E.coli to take up the plasmid RFP sfGFP Who Cares? questioning Dogma of Central Dogma answer questions Dogma doesn't predict
necessary for rational design in synthetic biology no time-money-interest in investigating caveats
vary length between start codons
small - single nucleotide
medium - 7 nucleotides
long - 34 nucleotides
vary RBS translation initiation rate of both start codons for every length
Further Applications Specific Aims to test the relationship between the number of nucleotides separating two start codons and the frequency of codon slippage to determine the relationship between varying ribosome binding site translation initiation rates and the frequency of codon slippage
Full transcript