Loading presentation...

Present Remotely

Send the link below via email or IM


Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.


Development of specific markers for the rapidly detection based on multiplex PCR in soybean


sung jin Han

on 15 July 2014

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Development of specific markers for the rapidly detection based on multiplex PCR in soybean

What are you doing?
Raffinose synthase gene search
Development of specific markers for the rapidly detection based on multiplex PCR in soybean
Go ahead and experiment
Continuous research
Lectin gene sequencing and primer design
Lipoxygenase1, 2, 3
Kunitz trypsin inhibitor
Gene exploraion
PCR product band Purification
Mutant line gene sequencing
Key of the study
·세부과제의 co-work으로 HPLC분석
·환경적인 요인? 유전적 요인?
·DNA level에서 Detection이 가능한가
·어떤 기작으로 만들어지는가?
·PCR amplification
·EtBr dyeing and
·Polyacrylamid gel
▶Polymorphic Primer design
by sung jin Han
15% soluble
(sucrose, stachyose,
raffinose, others)

Lipoxygenase 1, 2, 3
kunitz trypsin inhibitor
기능성 성분 우수
Mutant line specific detect primer
ddH2O : 9.8ul
Master mix : 2.77ul
F+R primer : 0.43ul
Taq : 1ul
DNA : 2.5ul
Pre-denaturation : 95℃ 4min

32cycle of
Denaturation : 95℃ 45s
Annealing : 47℃ 45s
Extention : 68℃ 45s

Last extention : 72℃ 8min

548392 w82
200508 1031 11B2-1
417227 507487
11B2-3 11B2-4 진양 다-7
Materials and

Matrials and Method
william82, PI200508, 10S31, 진양
11B2-1, 11B2-3, 11B2-4, 진품2, 다-7
PI417227, PI507487, PI548392
2. Parent test of size-related difference
☞ DNA Extraction
CTAB method
Fig1. Identify of three base pair deletion in mutant line
☞6% Polyacrylamid gel
☞ UV-vis Spectrophotometer
260nm, 50ng/ul
40% acrylamide : 14.992ml
0.5X TBE : 84.273ml
10% APS : 0.7ml
TEMED : 0.065ml
0.4932X TBE buffer
PCR product + 2ul loading buffer
200V 1hr 50min
Forward primer : 5′– TGGAGCAGGTGTATGTGTGG –3′
Revers primer : 5′– GTGTATAACGTCAACCTTAACA –3′
M w82
200508 10S31 11B2-1 11B2-3 11B2-4 진양
진품2 427227 538392 507487 M
Multiplex PCR
Raffinose & stachyose : HPLC분석
Development of specific gene marker
Primer design and primer blast
EtBr dyeing : 30min
Whashing : 10min
Phothraph : U;GENIUS
Result and Discution
☞ Parent screen sample
1. HPLC analysis
Extraction and purification of Raffinose, Stachyose and Sucrose
Analysis by HPLC
대두분말 200mg
60℃ water bath
during 2hr
2000rpm, 5min
60℃ heating block
Add 1.9ml 3D water
60℃ water bath
during 2hr
0.1ml 5-SSA
Overnight at 4℃
Centrifuge 300rpm 5min
상징액 0.8ml + 동량 3D water
Centrifuge 12,000rpm 10min at 4℃
상징액 0.2um filter 여과
3ml acetone
Instrument Agilent 1100 (Agilent, USA)
Column Supelcogel 610-H column (300 X 7.8 mm i.d., 9um, Supelco, USA)
Solvent 0.1% H3PO3
Flow rate 0.6ml/min
Injection vol. 10ul
Detector reflective index detector
Table2. Raffinose, stachyose and sucrose content by HPLC analysis
Fig2. Polymorphic DNA band in wild type and mutant strains
Mutant lines : T???, PI???, PI???
Expect of polymorphic band
Lectin : western blot
Kunitz trypsin inhibitor : SDS PAGE
Selection : DNA polymorphism band
Multiplex PCR : Detect several genes at once
Hitz, W.D., T.J. Carlson, P.S. Kerr, and S.A. Sebastian. 2002. Biochemical and molecular characterization of a mutation that confers a decreased raffinosaccharide and phytic acid
phenotype on soybean seeds. Plant Physiol. 128:65-660
Peterbauer, T., L. Mach, J. Mucha and A. Richter. 2002. Functional expression of a cDNA encoding pea(PisumsativumL.) raffinose synthase, partial purification of the enzyme from maturing
seeds, and steady-state kinetic analysis of raffinose synthesis. Planta 215:839-846
Peterbauer, T., L.B. Lahuta, A. Blochl, J. Mucha, D.A. Jones, C.L. Hedley, R.J. Gorecki, and A. Richter. 2001. Analysis of the Raffinose Famil yOligosaccharide Pathway in Pea Seeds with
Contrasting Carbohydrate Composition. Plant Physiol. 127:1764-1772
Skoneczka, J.A. Saghai Maroof, M.A. Shang, C. and Buss, G.R. 2009. Identification of Candidate Gene Mutation Associated With Low Stachyose Phenotype in Soybean Line PI200508. Crop
Sci. 49:247-255
Emily C. Dierking and Kristin D. Bilyeu. 2008. Association of a Soybean Raffi nose Synthase Gene with Low Raffi nose and Stachyose Seed Phenotype. The Plant Genome. 1:135-145.
Rita Maria Alves de Moraes, Tais Cristina Bastos Soares, Lucinete Regina Colombo, Maria Fernanda Spegiorin Salla, Josie Gomes de Almeida Barros, Newton Deniz Piovesan, Everaldo
Goncalves de Barros, & Maurilio Alves Moreira. 2006. Assisted selection by specific DNA markers for genetic elimination of the kunitz trypsin inhibitor and lectinin soybean seeds.
Euphytica. 149:221-226.
D.S.Kim, K.J.Lee, J.B.Kim, S.H.Kim, J.Y.Song, Y.W.Seo, B.M.Lee, S.Y.Kang. 2010. IdentiWcation of Kunitz trypsin inhibitor mutations using SNAP markers in soybean mutant lines. Theor.
Appl. Genet. 121:751-760
Kim.M.S, Park.MJ,Jeong.W.H, Nam.K.C, Chung.J. 2006. SSR markers tightly linked to the Ti locus in soybean[Glycinemax (L.)Merr.]. Euphytica. 152:361–366.
Schmutz. J, Cannon.S.B, Schlueter.J, Ma.J, Mitros.T, Nelson.W, Hyten.D.L, Song.Q, Thelen.J.J, Cheng.J, Xu.D, Hellsten.U, May.G.D, Yu.Y, Sakurai.Y, Umezawa.T, Bhattacharyya.M.K,
Sandhu.D, Valliyodan.B, Lindquist.E, Peto.M, Grant.D, Shu.S, Goodstein.D, Barry.K, Futrell-Griggs.M, Abernathy.B, Du.J, Tian.Z, Zhu.L, Gill.N, Joshi.T, Libault.M, Sethuraman.A,
Zhang.X-C, Shinozaki.K, Nguyen.H.T, Wing.R.A, Cregan.P, Specht.S, Grimwood.J, Rokhsar.D, Stacey.G, Shoemaker.R.C, Jackson.S.A. 2010. Genome sequence of the
palaeopolyploid soybean. Nature. 463:178–183
Song, Q.J., L.F. Marek, R.C. Shoemaker, K.G. Lark, V.C. Concibido, X. Delannay, J.E. Specht, and P.B. Cregan. 2004. A new integrated genetic linkage map of the soybean. Theor. Appl.
Genet. 109:122–128.

Total : 16.5ul
Resistration of a patent
Mutant lines gene sequecing
A plant introduction line, PI 200508, has been identified that has reduced levels of raffinose and stachyose and elevated levels of sucrose (Kerr and Sebastian, 2000).
Functionally Excellent gene
Poor quality material - Free
PI200508 : Raffinose synthase mutant
Phenotyping + Genotyping
Lectin gene : le1, le2, le3, le4...
transposable element에 의한 mutant.
Forward primer : ????????
Reverse primer : ????????
Full transcript