Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

MELAS!! LINA PICO

No description
by

LINA PICO

on 14 November 2012

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of MELAS!! LINA PICO

LUISA OVIEDO
LINA M. PICO
ANA. C. GONZALES
MARIA JOSE OSORIO ASIGNACIÓN SEMESTRAL



 Síndrome de MELAS



“miopatía mitocondrial, encefalopatía,
acidosis láctica y “stroke-like” episodios”
  MITOCONDRIA Las mitocondrias son orgánelos responsables de producir la mayor parte de la energía que se necesita para que funcionen nuestras células mediante la producción de ATP, Casi todas nuestras células dependen de las mitocondrias para tener una fuente estable de energía, la principal función de las mitocondrias es la oxidación de metabolitos (ciclo de Krebs, beta-oxidación de ácidos grasos) y la obtención de ATP mediante la fosforilación oxidativa, que es dependiente de la cadena transportadora de electrones. También sirve de almacén de sustancias como iones, agua y algunas partículas como restos de virus y proteínas, de manera que las enfermedad mitocondriales puede ser un trastorno de múltiples sistemas que afecta más de un tipo de célula, tejido u órgano. SÍNDROME DE MELAS SÍNDROME DE MELAS DEMENCIA

Enfermedad del Sistema Nervioso Central que se caracteriza por la aparición de múltiples síntomas o síndromes debido a la pérdida de las funciones superiores del Sistema Nervioso Central, aparecen síntomas tales como: alteraciones en la memoria inmediata y retrógrada, orientación, lenguaje, escritura, cálculo, alteración del pensamiento, capacidad de ejecución). Este déficit está determinado bien por la disfunción neuronal, o por la muerte de estás neuronas. Esta enfermedad o pérdida global de funciones tiene un curso progresivo e interfiere en las actividades de la persona, así como en su relación social y laboral. ATROFIA OPTICA

La atrofia del nervio óptico es una incapacidad permanente de la vista causada por daños al nervio óptico. La atrofia puede variar desde parcial, cuando algunos de los axones en la fibra nerviosa se encuentran dañados, hasta profunda, cuando lo están la mayoría. Puede afectar a un ojo o a los dos y también puede ser progresiva, dependiendo de la causa. Las áreas del ojo más vulnerables son las correspondientes a la zona central de la retina, la zona responsable de los detalles y el color (mácula).
MIOPATIA MITOCONDRIAL

Las miopatías mitocondriales son aquellas enfermedades en las que se ven afectados los nervios y músculos, entre otros sistemas por el mal funcionamiento de las mitocondrias, no proporcionando la energía necesaria que estas necesitan, produciendo una Alteración o enfermedad de los músculos esqueléticos.

El componente mitocondrial alterado es la citocromo c oxidasa, con ausencia de los citocromos a3 y b. COENZIMA Q Y RIBOFLAVINA CORTICOIDES

Estos fármacos se han utilizado en los brotes de MELAS administrando prednisona, dexameta-413 Protocolo de diagnóstico y tratamiento de enfermedades mitocondriales y en otras encefalomiopatías mitocondriales con brotes de ácidosis láctica Como potente agente antiinflamatorio se utiliza para actuar sobre el componente inflamatorio vasculítico y en el edema cerebral. De nuevo, existe una gran controversia entre los diferentes autores sobre la efectividad de este tratamiento, aunque dada la gravedad de los pacientes se aplica habitualmente L-ARGININA

La L-arginina es un precursor del óxido nítrico,que actúa como vasodilatador, por lo que puede tener un efecto positivo reduciendo la frecuencia y gravedad de los accidentes vasculares Se ha administrado en 24 pacientes con MELAS L-arginina por vía oral o endovenosa en la fase aguda de la enfermedad con resultados positivos SÍNDROME DE MELAS ENFERMEDADES MITOCONDRIALES Estas enfermedades están causadas por defectos en el genoma mitocondrial, que se hereda exclusivamente de la madre dado que la mitocondria es procedente de ella, normalmente tiene la mutación en el ADNmt, pudiendo o no presentar sintomatología clínica. El síndrome se puede manifestar en ambos sexos. SÍNTOMAS La deficiencia del Complejo IV Su expresión clínica depende de la cantidad de ADNmt mutante presente en los tejidos, si ésta es baja puede ser asintomática, pero si ésta es mayor puede manifestarse por acidosis láctica, Fanconi, cardiomiopatía retinopatía, ataxia, atrofia cerebelosa y miopatía. otras subunidades de la COX, que no se vieron directamente afectados por la mutación, también se redujeron. CADENA TRANSPORTADORA DE ELECTRONES MÉTODOS Se buscaron mutaciones en el gen que codifica para el tRNA de leucina por secuencia y por PCR en 34 pacientes, y se tamizó en familiares de los portadores de la mutación. Se tipificaron cuatro pacientes y familiares con la mutación A3243G.


AISLAMIENTO Y ANALISIS DE ADN


El ADN total se extrajo de las muestras de sangre entera periférica utilizando el QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Alemania). La paternidad y la maternidad fueron confirmados en muestras de familiares por la determinación del genotipo de los 15 marcadores. Amplificación por PCR y análisis de la secuencia

Seis pares de cebadores fueron diseñados para detectar mutaciones comunes (12 m.3243A> G, m.3291T> C, m.3460G> A, m.3271T> C, m.8344A> G, m.8356T> C, m.8363G > A, m.8993T> G / C, m.10158T> C, m.10191T> C, m.11778G> A y m.14484T> C.

Determinación de heteroplasmia

Los tipos de las mutaciones de ADNmt heteroplásmicas se determinaron mediante el cribado de clones bacterianos que tenían el correspondiente fragmento de ADNmt , Los fragmentos de ADN, obtenidas por amplificación PCR, se subclonaron en el vector pGEM-T Easy (Promega), que después se usó para transformar E. coli (DH5). La tasa de heteroplasmia se midió mediante el recuento de los clones que tenían una secuencia mutante.


GENOTIPIFICACION

En todas las muestras se extrajo el DNA utilizando el método modificado de fenol–cloroformo. Para identificar mutaciones en el gen mitocondrial que codifica para el tRNALeu se amplificó la región de mtDNA entre los nucleótidos 3162 y 3680, que contiene dicho gen y parte del gen NAD deshidrogenasa 1, usando los cebadores F 5'cgccttcccccgtaaatgat 3' y R 5'gccgatcagggcgtagtttg 3'. RESULTADOS Se obtuvieron 44 secuencias (34 correspondieron a los pacientes incluidos inicialmente en el estudio, 5 a familiares de pacientes en quienes se detectó la mutación, y 5 en controles), 9 de las cuales se compararon con una secuencia consenso, encontrando cinco polimorfismos (cuatro en el gen ND1 y uno en el gen tRNALeu). una citosina timina (CT), en la posición 3560, que como los anteriores es una sustitución sinónima, y finalmente, otro AG en la posición 3547, que cambia isoleucina por valina en la proteína de 11 pacientes (32,35%); en el gen tRNALeu se detectó la mutación AG en la posición 3243. En el gen ND1 seencontraron dos cambios timina citosina (TC) en las posiciones 3336 y 3396, localizados en la región codificante que no interfiere con la secuencia de la proteína por situarse en el tercer nucleótido del codón. Se ha reportado que las mutaciones más frecuentemente asociadas a MELAS, se deben a transiciones en el RNA de transferencia de Leucina, por lo que se vería afectada todas las síntesis de proteínas codificadas por el genoma mitocondrial, involucradas en la cadena respiratoria y fosforilación oxidativa, y por ende la producción de ATP



– Se encuentra una fuerte asociación entre la cantidad de MDNA detectado en sangre y saliva y síntomas que se han asociado al síndrome de MELAS, como talla baja y sordera, sin embargo, lo más rescatable es la asociación clara con migraña sin aura.
– En humanos pudiera existir un efecto del contexto genético nuclear y la cantidad de MDNA, pues con nuestro trabajo se apoya la hipótesis de que la segregación mitocondrial o replicación diferencial entre MDNA y normal es dirigida por genes nucleares.
El interés por el estudio de las citopatias mitocondriales ha crecido enormemente debido al gran aumento de pacientes diagnosticados con estos trastornos, los que además se pueden expresar a cualquier edad. Igualmente, muchas de estas mutaciones se trasmiten por línea materna, como se ha indicado anteriormente, lo que hace que el diagnóstico en un individuo pueda tener implicaciones para muchas generaciones de una familia.

tomografía computarizada muestra, en algunos pacientes, áreas hipodensas en los hemisferios cerebrales, durante los episodios agudos y calcificaciones en los ganglios basales. También se puede emplear la TC y la RNM para valorar el músculo.
Una prueba de sangre puede ser ordenada para que el laboratorio pueda buscar un aumento de lactato o moléculas de combustible sin usar, en la sangre o en el líquido cefalorraquídeo (liquido que baña el cerebro y la médula espinal).

Una prueba genética puede determinar si una persona tiene una mutación genética que causa enfermedades mitocóndriales. Idealmente, la prueba se hace utilizando material genético extraído de la sangre y de una biopsia muscular. Es importante saber que, aunque un resultado positivo de la prueba puede confirmar el diagnóstico, un resultado negativo no es necesariamente significativo. Ninguno de los síntomas distintivos de las enfermedades mitocóndriales (debilidad muscular, intolerancia al ejercicio, deterioro del oído, ataxia, convulsiones, discapacidades de aprendizaje, cataratas, defectos del corazón, diabetes y crecimiento atrofiado) son exclusivos de las enfermedades mitocóndriales. Sin embargo, una combinación de tres o más de estos síntomas en una persona constituye una fuerte indicación de enfermedad mitocóndrica, especialmente cuando los síntomas afectan más de un sistema de órganos.

El examen físico típicamente incluye pruebas de fuerza y resistencia, tales como una prueba de ejercicio. El examen neurológico puede incluir pruebas de reflejos, visión, habla y habilidades básicas de cognición. Dependiendo de la información obtenida durante la historia personal y los exámenes, el médico puede proceder a efectuar pruebas más especializadas que pueden detectar anormalidades en los músculos, el cerebro y otros órganos.

La biopsia muscular muestra generalmente, aunque no siempre, como se creía en un principio, las características “fibras rojo rotas”, que son de gran ayuda para el diagnóstico. Además de la biopsia muscular, pueden utilizarse técnicas no invasivas para examinar el músculo sin tomar una muestra del tejido. Por ejemplo, una técnica llamada espectroscopía de resonancia magnética de fósforo muscular (MRS) puede medir los niveles de fosfocreatina y ATP (que a menudo se agotan en músculos afectados por enfermedades mitocóndriales). Dos de los fármacos con mejor respuesta terapéutica en el tratamiento del síndrome MELAS.
los dos farmacos son capaces de mejorar las alteraciones fisiopatológicas detectadas en fibroblastos y cíbridos MELAS. Así, el tratamiento con Coenzima Q10 o Riboflavina aumenta la proliferación celular, acrecentando los niveles de ATP, reduciendo la producción de ROS (especies reactivas de oxígeno), disminuyendo la actividad mitofágica (eliminación selectiva de mitocondrias) e incrementando la expresión de proteínas y las actividades enzimáticas mitocondriales en fibroblastos y cíbridos MELAS” Episodios parecidos a apoplejía (hemiparesia, hemianopsia, ceguera cortical y afasia).
Acidosis láctica en sangre y líquido céfaloraquídeo, y fibras rojas rasgadas en biopsia muscular.
Convulsiones generalizadas o focales
demencia
vómito
cefalea recurrente. Talla baja
intolerancia al ejercicio
sordera
bloqueo cardiaco
ataxia cerebelosa atrofia óptica
oftalmoplejia externa progresiva
retinitis pigmentaria
diabetes mellitus tipo 2 de herencia materna
migraña
hemiplejía La m.3243A> G en el tRNALeu (UUR) se observó en 10 pacientes MELAS, seguido por m.8344A> G en los tRNALys de 4 pacientes MERRF.
Otros eran m.3271T> C en el tRNALeu (UUR), y m.10191T C> (Ser45Pro) en el ND3 de cada paciente MELAS, y m.8363G> A en las tRNALys de un paciente MERRF. m.3243A> G en el tRNALeu (UUR) (21,3%) y la m.8344A> G en las tRNALys (33,3%) eran los mas frecuentemente identificado en pacientes MELAS y MERRF coreanos respectivamente

la m.3243A> G se ha identificado en hasta el 80% de los pacientes MELAS , también se informó 90% de los pacientes tienen la mutación MERRF m.8344A> G. La frecuencia de detección de mutaciones baja podría ser debido que la pantalla mutacional se llevó a cabo mediante el uso de ADN de la sangre en vez del ADN del musculo afectado. Caso clínico EL ANÁLISIS EN LAS MITACIONNES DEL ADN MITOCONDRIAL EN PACIENTES CON MELAS

se buscaron mutaciones en el gen que codifica para el tRNA de leucina por secuencia y por PCR.

El propósito de este estudio fue identificar las mutaciones patogénicas del ADNmt en 61 familias coreanas no relacionadas (o pacientes aislados) con MELAS. conclusiones
Full transcript