Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Ultima asignación

Elías Samadi
by

Elias Samadi

on 17 June 2013

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Ultima asignación

Trabajo 3ª evaluación
Por Elías Samadi.
Genética
B-Ciencia que estudia las aplicaciones de la genética (Biotecnología)
CMC.
A 10 de Junio del 2013.

Síntesis de Proteínas
Pasos para la síntesis de proteinas:

1º Se forma una molécula nueva de ARN mensajero a partir de un segmento de ADN (Transquipción). La copia se realiza de forma complementaria, es decir, que si en el ADN hay una timina en el ARN aaparecerá la adenina
ADN ARN
timina -> adenina
adenina -> Uracilo
Citosina -> Guanina
Guanina -> Citosina
2º El ARR sale del núcleo y sufre un proceso de maduración en el cual se eliminan las bases de ARN que no sirven (Intrones) y permanecen las que sirven (Exones)

3º La traducción en el ribosoma:
-En primer lugar, se localiza el triplete de bases que marca el inicio de la traducción.
que siempre se corresponde con la Meteonina (AUG)
-Los aminoácidos están en el citoplasma unidos a unas moléculas llamadas ARN de traferencia y cada ARN de trasferencia tiene unos tripletes de bases propios de cada aminoácido
Ejemplo: Si la meteonina entra en la proteina cuando en el ARN mensajero aparece la secuencia AUG significa que en el citoplasma la metonina está unida a un ARN trasferente que contiene el triplete complementario UAC
ejemplo, traducir la siguiente secuencia de ADN
TTATACGGCAGTCAAGCTATTC
AAU
AUG
CCGUCAGUUCGA
UAA
G

AUG-> Meteonina
UAA-> No hay ningñun aminoácido codificado por ese triplete (Trilpetes de alto)
-Herramientas de la Biotecnología:
-> encimas de restricción: permiten aislar segmentos de ADN ( son moléculas de proteínas)
-> ADN ligasa: es otra encima que une fragmentos de ADN
-> Los Plásmidos: pequeñas moléculas de ADN que viven en el interior de las bacterias

-Como se fabrican proteínas con la Biotecnología
Se fabrica la insulina (La hormona del crecimiento)




1º ADN procedente
del páncreas + ADN de una bacteria
de una persona sana

Forma ADN recombinante

Ahora, en la bacteria se lleva acabo el proceso de fabricación de la isnnulina.
Y finalmente , se cultiva la bacteria
-Técnica de la Biotecnología

(Reacción en cadena de la polimerasa)
permite obtener una gran cantidad de ADN apartir de una muestra.
1º se necesitan cebadores, que son moléculas con unos 20 nucle´tidos aprox. y permite iniciar la reacción. La polimerasa es una proteína que facilita la unión de los nucleótidos
2º Se separan las hebras de ADN y por lo tanto los enlaces de hidrógeno
3º Se unen los cebadores a cada una de las hebras
4º Entra en acción la polimerasa introduciendo los nucleótidos en la cadena de ADN obteniendo asi dos dobles hélices
5º Se vuelve a separar el ADN obtenido
y se repite el proceso anterior
Celulas madre
Son aquellas células que pueden formar
otro tipo de células , es decir, no especializadas. Se distinguen dos tipos:

A: Totipotenciales, son aquellas que son capaces de formar un organismo completo( ejmplo un cigoto esta formado por estas células
B: Pluripotenciales, aqellas que pueden formar todo tipo de células . Distinguimos dos tipos
-Celulas madre embrionarias
-Células madre adultas
C: Multipotenciales, son células que solo pueden generar células de su mismo tipo
La células totipotenciales, pueden intervenir en un proceso de clonación (Obtener un individuo identico al progenitor
-Para que sean idénticos dos individuos, se necesitan:
Que el ADN sea el mismo y que no haya cruces de gametos.
En el caso de la clonación de animales, es necesario un óvulo, al cual se le extrae el óvulo sin romper la mebrana.
Ahora, aparte sacamos el núclo de una célula adulta y lo introducimos en las células adultas dentro del óvulo sin núcleo
Obteniendo un óvulo con el núcleo de la célula adulta. A los pocos días se desarrolla un embrión que se implanta en el animal que ha donado el óvulo. Y de este animal, nace otro exáctamente igual al animal donate de la célula adulta.
Cuando ocurre un asesinato, se compara la estructura de la molécula de ADN encontrada de la víctima con la del sospechoso.
Por ello, se lleva acabo el siguiente proceso:
1º aislalmos la célula por centrifugación
2º Se rompe la mebrana de la célula , los núcleos quedan sueltos y al volver a centrifugar conseguimos aislarlos en el fondo de la probeta.
3º Se rompe la mebrana nuclear y las moléculas de ADN salen del núcleo junto con las protínas
4º Se vuelve a centrifugar tras añadir un quuímico separando así proteinas del ADN.
5º Una vez obtenida la mol´écula de ADN se analiza.

En el ADN hay unas subunidades, las cuales tras disolverse actúan de una manera u otra. Se deja varios días de manera que por capilaridad se obtien la huella genética

Estructura del ADN:
El ADN, esta compuesto por unas subunidades denominadas nucleótidos que a su vez cada nucleótido esta formado por:

-Fosfato
-Desoxiribosa
-Base nitrogenada, que puede ser de cuatro tipos:
(Timina, Guanina, Citosina o Adenina)
Esto sería la estructura de una cadena de ADN, como en la molécula de ADN aparecen dos cadenas paralelas que se unen entre sí mediante las bases de forma complementaria.
-Una proteína es una molécula formada por la unión de unas moléculas mas sencillas denominadas aminoácidos. El ADN ayuda a organizar como se colocan los aminoácidos
-Terapia Genica:
Se emplea cuandoqueremos curar uan enfermedad que biene producida por el mal funcionamiento de una gen.
Entonces se sustituye porun gen sano. Hay dos técnicas:
-In vivo: introducimos un virus modificado en la persona que infecta las células y introduce el gen sano en ellas
-Ex-vivo: Extraemos las células dañadas, se sustituye el gen dañado y se cultivan las células ya corregicados y se vuelven a introducir en la cuerpo

Otra aplicación de la terapia génica son los trasgénicos.
Organismos modificados genéticamente en los que introduciendo un gen se obtienen unos beneficios
Ejemplo: El maiz trasgénico, se le introduce un gen, que al traducirse forma una proteína toxica para los escarabajos
El estado financia la investigación de enfermedades raras ya que el número de afectados suele ser muy bajo y nos hay empresas farmacéuticas privadas a las que les saslga rentable por lo que no les interesa desarrollar estos medicamentos
Medicamentos:
Full transcript