Loading presentation...

Present Remotely

Send the link below via email or IM


Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.


Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Cellular processes for AS, A2 and IB (SL and HL)

Intracellular processes for A level and IB Biology students

Alex Van Dijk

on 9 January 2013

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Cellular processes for AS, A2 and IB (SL and HL)

Nucleus Chloroplast Mitochondrion Ribosome Cell Membrane Photosynthesis Light-dependent reactions Light independent reactions Photosynthesis is the process by which plants turn inorganic carbon (in the form of atmospheric CO2) into organic carbon compounds The general equations you will remember from GCSE:
carbon dioxide + water -> glucose + oxygen
6CO2 + 6H2O -> C6H12O6 + 6O2 in reality, things are slightly more complex... Cell Biology A leaf is well adapted to carry out photosynthesis Green plant cells contain chloroplasts. These organelles are the site of photosynthetic reactions. Chloroplast are enveloped organelles, which means that they have a double membrane. It is thought that an early common ancestor of all plants absorbed a photosynthetic cyanobacteria and instead of being digested this bacteria formed a symbiotic relationship with its new host. Chloroplasts are adapted to the three processes essential for the capture of inorganic carbon:
capturing of light energy using pigments such as chlorophyll
carrying out the light-dependent reaction in the thylakoid membranes
carrying out the light-independent reaction in the stroma The light-dependent reactions of photosynthesis involve the capture of light whose energy is used for two purposes:
to generate ATP from ADP and Pi
To split water into H+ ions and molecular oxygen Oxidation and reduction can be described in 3 ways:
Oxidation: loss of electrons or loss of hydrogen or gain of oxygen
Reduction: gain of electrons or gain of hydrogen or loss of oxygen A photon is a quantum of light energy.
Photons provide the energy needed for photosynthesis. The membranes of the thylakoids contain protein complexes known as Photosystems. These photosystems contain a number of pigments including chlorophyll that will capture photons. In photosystem II chlorophyll absorbs this light energy and two electrons within the molecule are raised to a higher energy state (excited), leaving the molecule all together. The chlorophyll has been oxidised. The electrons from the chlorophyll are taken up by an electron carrier which is consequently reduced The electrons in the chlorophyll need to be replaced, otherwise the plant can't keep providing high energy electrons. A part of Photosystem II will use light energy to split water into hydrogen ions, electrons and oxygen
2H2O -light->4H+ ions + 4e- + O2
This is called the photolysis of water The electrons will move from electron carrier to electron carrier in a series of redox reactions, eventually ending up replacing the electrons in Photosystem I.
As the electrons move from electron carrier to electron carrier they move hydrogen ions from the stroma to the lumen. This generates a proton gradient across the thylakoid membrane, with a higher concentration in the lumen than the stroma.
The H+ ions will diffuse across the membrane through an enzyme called ATP synthase. The kinetic energy of the ions will provide the energy to catalyse the phosphorylation of ADP with Pi to form ATP Light excites more electrons in the chlorophyll of Photosystem I, which pass through another electron carrier into the stroma.
2 electrons and protons will react to reduce NADP+ to NADPH. This will move to the light-independent reactions. Two key words to take note of:
Photolysis of water (the splitting of water using light energy)
Photophosphorylation (the generation of ATP using light energy) Evidence for the light-dependent reactions In 1937 Robert Hill carried out a number of experiments that investigated the light-dependent reactions of photosynthesis. Chlorophyll absorbs photons with a certain frequency. You can see this from its absorption spectrum He identified chloroplasts as the site of photosynthesis, as was expected from people's knowledge of the differences between plant cells and animal cells..
How might he have done this? He used cellular fractionation to isolate chloroplasts, and then provided them with the raw materials he assumed they'd need (CO2 and water) He then investigated what would happen if he did not provide the chloroplast with CO2.
To his surprise O2 was still produced, as long as he provided an electron acceptor (usually DCPIP (2,6-dichlorophenol-indophenol) is used).
This showed that water was the source of the electrons prodced in the light-dependent stage of photosynthesis.
It also showed that you could easily study these reactions in vitro. One of the processes that takes place in the nucleus is transcription.
This allows the transfer of information from DNA to mRNA, which can move out of the nucleus and will be translated at the ribosomes into a protein. We will look at an overview of transcription to start. This is for A2 and SL and HL IB. More detail will follow for HL IB, Option 3 IB and A2, and this information will be labelled as such. RNA is single-stranded and for this reason transcription will only run along one strand of DNA. The RNA produced is complementary to the DNA strand it is copied from, substituting the Thymidine you would see in DNA for Uracil. Not all genes are transcribed all the time. The cell controls which genes are transcribed by using transcription factors and repressors, which will stop transcription occuring. An enzyme called RNA polymerase will bind to a site called the promoter on the DNA.
This site is located prior to the start of the DNA encoding for the gene the cell is going to transcribe. The RNA polymerase complex unwinds and separates the DNA strands downstream from the promoter region.
RNA nucleotides pair in a complementary fashion with their counterparts on the DNA template strand.
The non-template strand of DNA is known as the coding strand as its sequence is identical to the mRNA produced (apart from the T -> U substitutions) RNA polymerase then forms the phosphodiester bonds between the nucleotides.
The RNA formed then separates from the DNA and the double helix reforms.
This process continues until a stop codon is reached after which the RNA polymerase complex detaches.
The cell has produced a pre-mRNA strand that will be further processed into a mature mRNA strand. What would the sequence of mRNA be if the template strand of DNA was as follows:
TTAGGCCCTTAAAAATGGCCGCCGG? AAUCCGGGAAUUUUUACCGGCCGCC Translation is the process by which the information in mRNA is turned into an amino acid sequence that will result in a particular protein, with a specific shape. In translation, a sequence of 4 nucleotides (A, U, G and C) must allow the cell to code for all 20 amino acids found in most organisms.
Obviously 1 nucleotide coding for 1 amino acid would not work, as there could only be 4 amino acids.
2 nucleotides would be able to produce 4^2 amino acids. (16)
3 nucleotides allows the cell to produce 4^3 amino acids. (64) This allows for a considerable amount of degeneracy. Many amino acids are coded for by multiple 3 nucleotide sequences (codons). Why might this be a good thing? It provides protection against mutation AUG - codes for methionine.
This codon will always be the first to be translated, and is known as the START codon. It can appear later in the RNA sequence as well. Three codons (UAA, UAG and UGA) do not code for an amino acid. These are known as STOP codons. Translation will stop after one of these codons. Translation occurs at the ribosomes in the cytoplasm, and attached to the rough endoplasmic reticulum Ribosomes consist of large and a small subunit. Ribosome are protein:RNA complexes. The mRNA will bind to the small subunit of the ribosome
The free tRNA molecules carrying amino acids bind their anticodon to a complementary codon.
Two tRNA molecules are bound at once, and the ribosome catalyses the formation of a peptide bond between the two amino acids carried.
Once the bond is formed, the first tRNA leave and ribosome moves along to the next codon, recruiting another tRNA.
This repeats until a stop codon is reached, forming a long polypeptide, which then fold into a protein. Another form of RNA is present in the cytoplasm of the cell. This is transfer RNA (tRNA).
The key features to note about tRNA are:
the anticodon, which will bind to the codons on the RNA
the fact that it carries a specific amino acid (depending on the anticodon) ATP + NADPH + H+ The products of the light reaction (ATP and NADPH) are used to reduce carbon dioxide in light-independent stage of photosynthesis. This takes place in the stroma of the chloroplast. Typically however, the light-independent stage will stop swiftly after light has stopped being supplied to the plant as it relies on the products of light-dependent reaction. CO2 Ribulose Bisphosphate (RuBP) (5C) CO2 combines with RuBP
using an enzyme known as RuBisCo (Ribulose-1,5-bisphosphate carboxylase oxygenase, so you can see why it's shortened). This process is known as carbon fixation. Glycerate 3-phosphate (GP) This forms two 3C molecules. Triose phosphate (TP) ATP ADP + Pi NADPH + H+ NADP+ Glycerate 3-phosphate (GP) Triose phosphate (TP) ATP ADP + Pi Organic compounds such as glucose. The Calvin Cycle Reduction: ATP and reduced NADP (NADPH + H+) are used to reduce GP to TP. The NADP+ recycles to the light-independent reaction. 1 in 6 TP's formed will go on to produce organic compounds Regeneration of acceptor:The other 5 TPs are recycled back to RUBP using ATP. Why is it essential that most of the TP molecules recycle to form RUBP again? A2 Look at the How Science Works section on p39-40 for a description of how Calvin deduced this cycle. O2 Organic compounds ATP All living things require energy to survive.
All of this energy comes originally from the Sun.
Animals use the chemical energy in plants to provide them with energy. Energy:
exists in various forms
can be transformed from one form to another
Cannot be created or destroyed
Is measured in Joules (J) Why do organisms need energy? metabolism
active transport
maintenance, repair and division of cells and organelles
production and secretion of hormones, enzymes, etc
maintenance of body temperature ATP is used as an energy currency in the cell.
It is mainly generated by aerobic respiration.
ATP is then used to provide energy to various processes in the cell.
This energy might be in the form of thermal energy, in the form of a high energy bond (phosphorylation) or various other, little understood mechanisms. ATP is adenosine triphosphate.
Where have you seen a molecule like this before? ATP is hydrolysed to ADP and Pi (inorganic phosphate), releasing energy (approx 30.6 kJmol-1). This is also known as dephosphorylation.
ADP can also be hydrolysed to AMP and Pi releasing another 30.6kJmol-1.
AMP can be hydrolysed to Adenosine releasing more energy (but significantly less than the first two). ATP is formed by the condensation reaction between ADP and Pi, releasing water. This also known as phosphorylation (addition of a phosphate). This reaction will take 30.6kJmol-1 worth of energy.
The protons moving through ATP synthase will provide this energy through the proton motive force. ATP can be generated in 3 ways:
Photophosphorylation in photosynthesis
Oxidative phosphorylation in mitochondria during aerobic respiration
Substrate level phosphorylation (when ADP gets a phosphate group from a donor molecule) Aerobic respiration will use oxygen and produce carbon dioxide and a lot of ATP.
Anaerobic respiration (fermentation) will not use oxygen and produce lactate (in animals) or ethanol and carbon dioxide (in plants and fungi) and a little ATP. Glycolysis Glycolysis occurs in the cytoplasm.
It is the splitting (lysis) of glucose (glyco) into two 3-carbon molecules (pyruvate) C C C C C C Glucose 2ATP -> 2ADP + 2Pi The hydrolysis of two ATP molecules allows for the double phosphorylation of the glucose molecule. This will lower the activation energy required for the next steps in glycolysis. C C C C C C fructose bisphosphate P P C C C C C C P P The phosphorylated glucose is split into two triose phosphate molecules which are phosphorylated again NAD -> NADH 2 ADP + 2 Pi-> 2ATP NAD -> NADH 2 ADP + 2 Pi-> 2ATP Each of the triose phosphate molecules is oxidised, losing 2 H atoms, which are accepted by NAD (a hydrogen-carrier molecule). Each triose phosphate molecule will then be turned into a molecule of pyruvate, in the process phosphorylating two molecules of ADP into ATP. C C C C C C Pyruvate Pyruvate So the net products of the glycolysis of one glucose molecule are:
2 pyruvate molecules
2 NADH (reduced NAD) molecules
2 ATP molecules (generates 4, uses 2) All organisms can carry out glycolysis to generate some energy.
Most bacteria will only be able to use glycolysis to generate ATP.
Anaerobic respiration will only involve glycolysis. Extra Info not needed! Summary of DNA, transcription and translation
DNA is not kept in the nucleus of eukaryotic cells just as a helix. Instead it is packaged to condense the space needed for the DNA. Each human nucleus contains approximately 2 metres of DNA.
This is packaged up into 46 chromosomes which are on average 5 micrometres in length. The DNA is supercoiled and then wrapped around a set of 8 histone proteins, forming a nucleosome Nucleosomes will coil up and form a thicker fibre-like structure known as chromatin by winding around a scaffold protein fibre made out of non-histone proteins. During cell division this will allow you to see individual chromosomes. In interphase (when the cell is in between divisions), the DNA will be coiled up around nucleosomes but not into chromatin. IBDP HL and Option 3 only:
Further details of gene expression The three stages of the process by which the information of a gene are turned into a protein molecule are:
Transcription - a copy of the DNA code is made by building a molecule of mRNA formed by the complementary base pairing of RNA nucleotides with the non-coding strand or template strand of DNA. The mRNA leaves the nucleus and passes to the ribosome.
Amino acids are activated for protein synthesis by binding to tRNA molecules. The tRNA molecules contain an anti-codon that is complementary to the mRNA sequence.
Translation - a protein is assembled 1 amino acid at a time by ribosomes moving along the mRNA strand 'reading' the codons. tRNA molecules with complementary anti-codons are recruited. Peptide bonds are formed between adjacent amino acids. Genes are regulated in cells, and only those genes are expressed that the particular cell type needs.
Remember that DNA is only transcribed if RNA polymerase can bind to the promoter upstream of the gene. As a result the following three scenarios can occur:
RNA polymerase can always bind to the promoter of the gene, resulting in continuous expression of the gene.
RNA polymerase can only bind if a regulatory protein is bound to the promoter.
The regulatory proteins need to be have their gene expression or protein product activated by binding with a signalling molecule or metabolite. Gene regulation can also occur as result of post-transcriptional modification of the mRNA molecule, or by post-translational modifications to the protein product. A large number of eukaryotic genes have non-coding regions within them. The parts of the gene that contain coding information are known as exons; those that do not, introns.
After transcription enzymes will remove the introns from the RNA formed, attaching the exons together. This is known as post-transcriptional modification, or mRNA splicing. The strands in transcription Sense Strand Antisense Strand Carries the promoter sequence to which RNA polymerase binds.
has the same base sequence as mRNA (except for T instead of U)
carries the terminator sequence of bases at the termination of each gene that causes RNA polymerase to stop transcription
Also known as the coding strand Is the template sequence for transcription by complementary basepairing by RNA polymerase
Has the same base sequence as the anticodons on the tRNA. (T instead of U)
is 'read' in the 3' to 5' direction and mRNA synthesis occurs in the 5' to 3' direction.
Also known as the template strand or non-coding strand. Translation details forA2 and HL IBDP These products are in the cytoplasm however and need to be moved into the mitochondria. This happens in the Link Reaction. The link reaction will oxidise the pyruvate and attach a coenzyme (CoA) to the molecule. C C CoA NADH <- NAD+ CO2 CoA The Link reaction Pyruvate is oxidised by the removal of a hydrogen atom. This hydrogen atom is used to reduce NAD+. Pyruvate is decarboxylated, releasing CO2. The 2C molecule formed (acetyl) is attached to Coenzyme A (CoA). This can then move into the mitochondrial matrix. Acetyl CoA Krebs Cycle C C CoA C C C C C C C C C C C C C C C C Oxaloacetate (4C) Citrate (6C) 5C CO2 NADH +H+ <- NAD+ 2NADH + 2H+ <- 2NAD+ FADH +H+ <- FAD+ CO2 The acetyl-CoA is moved into the matrix of the mitochondrion It will react with a 4 C compound (oxaloacetate) The products of this reaction are a 6C compound (citrate) and CoA (which goes back to the inter-membrane space) The citrate is decarboxylated and oxidised, producing a 5C compound, CO2 and NADH + H+ The 5C compound is decarboxylated and oxidised 3 times, producing oxaloacetate, 2 reduced NADH, 1 reduced FADH, CO2 and 3 H+. This cycle is known as the: ATP <- Pi + ADP The following products have been formed as a result of the breakdown of glucose. Products CO2 ATP NADH FADH Step Total Glycolysis Link Reaction Krebs Cycle 0 0 0 0 2 2 2 2 2 2 4 6 6 4 10 2 The CO2 is a waste product, and will be excreted (into the cytoplasm and then the blood in humans).
ATP will be used to power cellular processes, including some of those involved in respiration (eg active transport of glucose)
The reduced Hydrogen carriers NADH and FADH will move on to the next stage of aerobic respiration. Outer Membrane Inner Membrane Inter-membrane space Matrix This next stage is oxidative phosphorylation involving chemiosmosis.
It takes place in the inner membrane and inter-membrane space of the mitochondria Dehydrogenase enzyme and proton pump Proton pump and oxidase enzyme Proton channel and
ATP synthetase NADH + H+ NAD+ H+ H+ 2e- 2e- 2e- H+ H+ FADH + H+ FAD+ H+ 2e- H+ H+ 2H+ + 1/2 O2 H2O H+ H+ H+ H+ H+ H+ H+ H+ H+ H+ H+ H+ H+ H+ ADP + Pi ATP Oxidative phosphorylation mostly happens in the inner membrane (forming the cristae) of the mitochondrion. It involves: 1. At the first dehydrogenase, NADH is oxidised to NAD+, freeing 2 electrons and a proton. The proton is joined by another proton and pumped across the membrane 2. NAD+ is recycled to the Krebs Cycle.
The 2e- produced are passed on to electron carriers that carry it down the electron transport chain. 3. At the second dehydrogenase FADH is given the same treatment as NADH at the first one.
It is also an electron acceptor, and will pump more H+ into the inter-membrane space by using the high energy electrons from NADH. 4. The final electron acceptor will also pump some more protons into the inter-membrane space. 5. The 2 electrons will combine with two protons and 1/2 an O2 molecule to form water. This is carried out by an oxidase enzyme. 6. The pumping of protons into the inter-membrane space and the use of protons by the oxidase enzyme to create water, results in a large proton gradient across the inner membrane. 7. The diffusion of the protons through the proton channel powers the ATP synthetase using proton motive force.
This results in the creation of ATP. This process is known as chemiosmosis. Active transport is the transport of a substance against a concentration gradient using energy (usually in the form of ATP) and carrier molecules. Active Transport There are 4 main differences between active and passive forms of transport across a cell membrane. Metabolic energy in the form of ATP is needed
Materials move against rather than with the concentration gradient
Carrier membrane proteins which act as pumps are involved
The process is highly selective, with only specific molecules being transported. ATP is used:
to directly provide the carrier proteins with energy to pump the molecules
to set up a concentration gradient of another substance (eg Na+) resulting in co-transport This particular active transport system is pumping a substance out of the cell.
1. The ligand (the substance) will bind to the carrier protein. 2. ATP will bind to the carrier protein and be dephosphorylated. The phosphate will bind to the carrier protein.
3. This changes the shape of the carrier protein and opens it up to the other side of the membrane. 4. The change in shape causes the ligand to be released.
5. The ligand releasing causes other changes, releasing the phosphate. The carrier protein's shape resets to the original version. The sodium-potassium pump will move Na+ ions out of the cells whilst moving K+ ions into the cell, creating concentration gradients of both. This pump is essential in many physiological processes. A tRNA molecule has a clover leaf like structure. It largely consists of RNA nucleotides and these form 3 loop sections and a stem by partial hydrogen-bonding between the nucleotides. The three loop regions are involved in binding to other molecules (enzymes, ribosomes or mRNA). The stem is the site of attachment for the amino acid. For a tRNA to be used in translation it needs to activated with a specific amino acid.
A specific enzyme (1 for each of the 20 possible amino acids) catalyses the reaction between the amino acid, the tRNA and ATP, producing an activated tRNA carrying the amino acid, AMP and 2 inorganic phosphates. There are 3 sites on the small sub-unit of the ribosome with which the tRNA will react:
The A site where a new tRNA will bind to (with the exception of the tRNA with the AUG anti-codon)
The P site where the tRNA that was in the A site previously is now. A peptide bond is synthesised between the amino acids held by the tRNAs in the A and P sites.
The E site, from which the tRNA without an amino acid will exit the ribosome. Multiple ribosomes will be reading the same mRNA, producing many copies of the protein product. This forms a polysome (many ribosomes) Anaerobic Respiration In the absence of oxygen the formation of water cannot occur at the end of the electron transport chain.
This means that the electrons from the hydrogen atoms cannot be used to produce water, so the electron transport chain grinds to a halt.
This means that the hydrogen acceptors NADH and FADH cannot be oxidised, and will not be recycled.
The Krebs cycle and the link reaction cannot occur without NAD+ and FAD+.
Aerobic respiration grinds to a halt. Anaerobic respiration will occur instead. Anaerobic respiration involves glycolysis, and to keep it working the cell needs to get rid of pyruvate and, especially, the hydrogen on the NADH so that the NAD+ can be recycled back and used again. In plants and yeast this happens by pyruvate losing CO2 and gaining the hydrogen atoms from NADH producing ethanol. pyruvate + NADH ethanol + carbondioxide + NAD
C3H4O3 C2H6O + CO2 + In animals, the pyruvate will accept the hydrogen atoms from the reduced NAD, turning into lactate pyruvate + NADH lactate + NAD
C3H4O3 C3H6O3 In both the NAD+ can accept more hydrogen atoms in glycolysis. This allows glycolysis to continue, forming 2 ATP per glucose molecule that is broken down.
This means that anaerobic respiration is 1/19th the efficiency of aerobic respiration. + IB pathway starts here P P Pi Pi A2 Start IB: Regeneration of RuBP C5 C5 C5 Ribulose bisphosphate C3 C3 C3 C3 C3 C3 Glycerate 3-phosphate +CO2 +CO2 +CO2 C3 C3 C3 C3 C3 C3 Triose phosphate +ATP
+NADPH + H+ C6 C5 C4 C7 C5 C5 +ATP +ATP +ATP RuBP RuBP RuBP Synthesis of Biological molecules IB: Product Synthesis CO2 GP
(3 carbon phosphorylated sugar) TP (3 carbon phosphorylated sugar) Ribulose Bisphosphate
(acceptor molecule) Exclusive to Calvin Cycle Photosynthesis Respiration pathways Formation

of metabolites Phosphorylated 6 carbon sugars Glucose Sucrose Starch and Cellulose Glycerol Pyruvate Fatty acids Lipids Acetyl-CoA alpha-ketoglutarate NO3- from soil NH3 amino acids
Full transcript