Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Tese doutorado

Tese de doutorado Bacillus thuringiensis
by

Gabriela Alles

on 26 October 2012

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Tese doutorado

Tese apresentada como requisito parcial para a obtenção do título de Doutor em Biologia UNIVERSIDADE DO VALE DO RIO DOS SINOS
PROGRAMA DE PÓS GRADUAÇÃO EM BIOLOGIA
DIVERSIDADE E MANEJO DA VIDA SILVESTRE Orientadora: Dra. Lidia Mariana Fiuza
Co-Orientador: Blair Siegfried Gabriela Alles 2012 Análise do potencial de Bacillus thuringiensis
como agente de controle de
Spdoptera frugiperda e Ostrinia nubilalis Introdução População mundial constante crescimento
Áreas agrícolas cultivadas decrescem. Novas estratégias para utilizar os recursos naturais de forma eficiente e também sustentável. Agricultura ataque de insetos fitófagos. MIP Bacillus thuringiensis Bactéria gram-positiva caracterizada pela produção de um cristal paraesporal na célula mãe contém delta-endotoxinas ativas a diversas ordens de insetos

Mecanismos de ação do B. thuringiensis levam a septicemia e morte do inseto

Fatores: proteases dos grupos de insetos - ativam as protoxinas Plano de apresentação Introdução Objetivo geral Aplicar metodologias tradicionais (dependente de cultivo) e moleculares (independente de cultivo), em estudos de ecologia e diversidade genética, estimando a biodiversidade bacteriana de Bacillus thuringiensis, em áreas de arroz irrigado no RS. Desta forma, contribuindo para a conservação da biodiversidade em agroecossistemas e para a avaliação do potencial de novos grupos bacterianos como bioindicadores da qualidade destes ecossistemas. Objetivo geral MARCADORES MOLECULARES PARA ESTUDOS DE DIVERSIDADE DE MICRORGANISMOS Década de 90 Fenotipagem e Genotipagem Morfologia de colônias
Testes bioquímicos
Sorológicos
Patogenicidade
Antibióticos Padrões de bandas de DNA
Sequenciamento de DNA
Hibridização do DNA Métodos em padrões de bandas de DNA Classificam de acordo com o tamanho dos fragmentos gerados por amplificações por PCR ou digestão do DNA genômico por endonucleases de restrição ou uma combinação de ambos PCR - Reação em Cadeia da Polimerase RAPD - DNA polimórfico amplificado ao acaso rep-PCR- Seqüências palindrômicas extragênicas repetidas RFLP - Polimorfismo do tamanho de fragmentos de restrição PCR-RFLP - Fragmentos de DNA obtidos por Enzimas de Restrição MLVA- Análise do Número Variável de Repetições em Tandem Métodos baseados em seqüenciamento de DNA Leitura das bases de nucleotídeos de uma molécula. Inclui qualquer método para determinar a ordem das quatro bases: adenina, guanina, citosina e timina, em uma cadeia de DNA MLST - Multilocus Sequence Typing
Método Sanger
Pirosequenciamento Métodos baseados em hibridização do DNA Consiste em fragmentos marcados de DNA ou RNA complementar à seqüência de um gene-alvo de interesse e permite não só o estudo de organismos isolados e cultivados como também estudo destes organismos em amostras ambientais RNA Ribossômico como Marcador Filogenético Microarray ou Microchips de DNA FISH- Hibridização in situ fluorescente PHENOTYPIC CHARACTERIZATION AND THE APPLICATION OF THE REP-PCR TECHNIQUE IN A STUDY OF NEW STRAINS OF BACILLUS THURINGIENSIS IN THE SOUTH OF BRAZIL Capítulo 3 Introdução: Bacillus thuringiensis é o biopesticida mais utilizado. A toxicidade deriva da produção de proteínas específicas (delta-endotoxinas) durante a esporulação. Obetivo: Analisar fenotipicamente e molecularmente 26 cepas de B. thuringiensis do Sul do Brasil avaliando semelhanças intra-específicas e homogeneidade interna Material e Métodos: Isolados - 5 regiões orizícolas Análise Citomorfológica: Microscopia óptica a fresco
método de Gram
Dimensão das células

Localização do esporo

Deformação

Forma do esporo

Corpo paraesporal Esporo, esporângio e célula vegetativa Testes Fenotípicos Compostos Orgânicos: Cepas crescimento 48h - MUG (10mL)


Etanol (150 e 250µL);
Creolina (40 e 60µL);
Fenol (40 e 60µL);
Xylol (150 e 250µL)
5 dias - 30°C Fipronil
Pirazosulfuronetil Quincloraque
Propanil
Azoxistrobina Pesticidas químicos: Ingrediente ativo: Klap®
Sirius®
Facet®
Stam®
Priori® B. thuringiensis Pesticidas químicos Placas de Petri Inibição do Crescimento Análise das proteínas em SDS-PAGE a 10%: Preparo de amostras:

- Crescimento Meio Usual - Centrifugação
- Ressuspensão do pellet - Aplicação no gel Separação de moléculas – massa molecular Análise de Amplificação de sequências repetidas (rep-PCR) Amplificação de regiões repetidas presentes em número variável no genoma de bactérias Rep 1 (5'-ATTAAAGTTTCACTTTAT -3')
Box (5' CTACGGCAAGGCGACGCTGACG -3')
Eric (5’-TGTAAGCTCCTGGGGATT Primers controle +: B. thuringiensis thuringiensis 4412 . Amplificação: desnaturação (5 min. a 94ºC, 40 ciclos a 94ºC por 1 min), seguido de 45ºC por 30 seg e 65ºC por 4min. Extensão 10 min a 72ºC.

Visualização - luz UV, solução de brometo de etídio Os testes foram transformados em matrizes binárias e avaliados com um programa de análise numérica NTSYS-pc (2,1 versão). Testes bioquímicos: parâmetros comuns da espécie com pequenas variações. Fenogramas gerados de pesticidas químicos e compostos orgânicos são semelhantes aos gerada para SDS-PAGE.

Nos 2 ensaios formaram 5 grupos, que contêm linhas da mesma região geográfica as cepas responderam de forma semelhante Compostos orgânicos: Apresentaram crescimento variado nas diferentes concentrações dos compostos. Fenograma resulante da análise numérica dos dados obtidos do crescimento na presença de compostos orgânicos. Pesticidas químicos: todas as cepas foram S ao herbicida Stam e apresentaram crescimento variado nos demais. SDS-PAGE 5 grupos
Grupo I = B. thuringiensis thuringiensis 4412. Grupos II e III: Estirpes não-tóxicas com bandas de 25, 40, 55 e 100 kDa e 40, 50, 80 e 110 kDa

Grupo IV e V: bandas com peso de 25, 50, 80 e 110 kDa e 25, 50, 55, 80 e 145 kDa. Protein profile of the crystals of strains B. thuringiensis. Line: (1) IRGA 31-18; (2) IRGA 42-8; (3) IRGA 32-2 ; (4) IRGA 29-8; (5) Molecular weight marker (kDa); (6) IRGA 44-12; (7) IRGA 03-1; (8) IRGA 35-13; (9) IRGA 28-9. (10) IRGA 38-14 Protein profile of the crystals of strains B.thuringiensis Line: (1) Molecular weight marker kDa); (2) IRGA 24-5; (3) IRGA 24-9; (4) IRGA28-6; (5) IRGA 47-1; (6) IRGA 47-2. (coeficiente de correlação cofenética = 0.91) rep-PCR 5 Grupos Polimorfismo (número de bandas encontrados para o conjunto de iniciadores) variou de 3 a 9 e tamanho das bandas entre 0,4 e 3,4 kb. 1: Cepas (Depressão Central) – 5 a 9 bandas: 0.5 a 2.0 kb.
2: Litoral Norte - 6 a 11 bandas: 0,8 a 3,0 kb.
3: Campanha -5 a 10 bandas: 0,5 a 2,5 kb.
4: Fronteira Oeste -3 a 9 bandas: 0,4 a 1,8 kb.5: Cepas 5: Litoral Sul- 6 a 13 bandas: 1,0 a 3,4 kb. 1 2 3 4 5 6 7 8 9 Perfil se sequiencias repetidas de cepas de B. thuringiensis. REP1. Line: (1) Molecular weight markerr (1kb DNA ladder, Invitrogen); (2) IRGA 06-1; (3) IRGA 34-1 ; (4) IRGA 03-1; (5)IRGA 35-13; (6) IRGA 42-8; (7) IRGA 42-9; (8) IRGA 47-1; (9) IRGA 47-2. 1 2 3 4 5 6 7 8 9 Perfil se sequiencias repetidas de cepas de B. thuringiensis. BOX. Line: (1) Molecular weight markerr (1kb DNA ladder, Invitrogen); (2) IRGA 71-3; (3) IRGA 71-9 ; (4) IRGA 31-18; (5) IRGA 28-9; (6) IRGA 28-6; (7) IRGA 10-1; (8) IRGA 24-9; (9) IRGA 24-5. O presente estudo aplicabilidade dos processos fenotípicos aliados a rep-PCR, mostrou ser altamente seletiva, rápida e capaz de identificar linhagens distintas.
Os resultados para os ensaios mostraram uma resposta muito semelhante às estirpes da mesma região, demonstrando um elevado grau de clonalidade associado com, provavelmente, a especialização ecológica. Periódico: Journal of Invertebrate Pathology SCREENING OF BRAZILIAN BACILLUS THURINGIENSIS STRAINS ISOLATED FROM SAMPLES SOILS FROM IRRIGATED RICE FIELDS Capítulo 4 Introdução e objetivos A identificação e caracterização de novas cepas de B. thuringiensis podem ser de grande valor devido à ação altamente específica sem efeito em outros insetos não-alvo. Objetivo deste estudo foi a caracterização de cepas de B. thuringiensis isoladas de amostras de solo de regiões de arroz irrigado. 20 isolados de B. thuringiensis Material e Métodos FO: Fronteira Oeste
CA: Campanha
DC: Depressão Central
LI: Litoral
NR: Não Orizícola Testes fenotípicos Testes bioquímicos e citomorfológicos específicos. (Gordon et al., 1973) Bioensaios com S. frugiperda Antimicrobianos Técnica de difusão de discos impregnados (NCCLS, 2003). Triplicata - 20 insetos por tratamento Foram utilizadas lagartas de S. frugiperda (2° ínstar) oriundas da Embrapa/CENARGEM, acondicionadas individualmente em dieta de Poitaut. Isolados: MUG, 28°C, 180rpm/48hs - concentração determinada: Câmara de Neubauer e microscopia. Tratamentos acondicionados em câmara climatizada, sendo a mortalidade avaliada no 3, 5 e 7° dia após a aplicação dos tratamentos (DAT) e corrigida (MC%) pela fórmula de Abbott Análise das proteínas em SDS-PAGE - 10% - Separação de moléculas – massa molecular (Método Laemmli, 1970) Preparo de amostras:
- Crescimento Meio Usual - Centrifugação- Ressuspensão do pellet - Aplicação no gel Análise de PCR Extração de DNA (Hansen & Hendriksen, 2001) 5 pares de primers (Ben-Dove et al.,1997, 1999)
cry1Ab, cry1F, cry1B, Cry1C e cry1D. Amplificação: 35 ciclos, tampão TBE Volume final de 25µL: desnaturação - 5min a 94°C, seguida de 30 ciclos de desnaturação 94°C por 1min, anelamento - 2min a 56°C, e polimerização a 72°C por 1,5min e extensão final de 72°C por 7min. Controle negativo: sem DNA Resultados Microscópio interferencial de contraste de fase ZEISS Software Axion Vizion SF64. Testes fenotípicos = parâmetros característicos Microscópio interferencial de contraste de fase ZEISS Cepa 3420-10 Cepa: 1893-24 Bioensaios Cepa 3420-11 apresentou 88,8% MC Antibiograma 100% resistentes a Penicilina e Vancomicina Sensíveis ao Clorafenicol SDS-PAGE 4 grupos: 1: cepa tóxica 3420-11
2: cepas 5 cepas - Fronteira Oeste
3:Cepas - Litoral
4: Cepas Depressão central PCR Presença dos genes cry1C e cry1F genes cry1Ab, cry1B e cry1D - não amplificaram Gene cry1F amplificou em 3 regiões: Fronteira Oeste, Campanha e Depressão Central. Gene cry1C : Litoral, Campanha, Fronteira Oeste e Depressão central M 1 2 3 4 5 6 7 8 9 10 11 12 NC Presence of cry1F in B. thuringiensis isolates. (M) Marcador Molecular (100pb, Gibco BRL); (1) 1893-16; (2) 2835-4; (3)1893-24; (4) 1490-5; (5) 3420-10; (6) 3133-3; (7) 3280-1; (8) 1458-4; (9) 1458-1; (10) 1458-2; (11) 1829-2; (12)1893-7; (CN) Controle Negativo. M CN 1 2 3 4 5 6 7 8 9 10 11 12 Presence of cry1C in B. thuringiensis isolates. (M) Marcador Molecular (100pb, Promega) (CN) Controle Negativo; (1) 2835-4; (2) 1893-24; (3) 1547-1; (4) 1490-5; (5) 3420-10; (6) 3419-1; (7) 3280-1; (8) 1458-4; (9) 3420-5; (10) 1829-2; (11) 3420-6; (12) 1893-13. Periódico: Applied and Environmental Microbiology Capítulo 5 BIOLOGICAL CHARACTERIZATION OF BACILLUS THURINGIENSIS STRAINS AGAINST OSTRINIA NUBILALIS Ostrinia nubilalis (a broca européia do milho, ECB) é uma praga cosmopolita de milho Perdas de US$ 1 bilhão/ano Introdução Identificação da novas linhagens ativas para as pragas de culturas economicamente importantes Objetivo Caracterizar fenotipicmente e molecularmente cepas de B. thuringiensis frente a lagartas O. nubilalis (perfil R e S a cry1Ab e cry 1F. Material e Métodos 7 cepas Testes fenotípicos Testes microbiológicos convencionais
Produção de catalase e redução de nitrato Antibióticos: Crescimento 48h + placas BHI
Streptomicina, eritromicina e rifampicina Bioensaios com Ostrinia nubilalis Lagartas de 1° ínstar de O. nubilalis acondicionadas individualmente em dieta de Gérmem de Trigo. Os tratamentos foram acondicionados em bandejas com 128 poços em câmara climatizada, sendo a mortalidade avaliada no 7° dia após a aplicação dos tratamentos (DAT). Colônias: SKY: Resistente a toxina Cry1Ab
KS: Resistente às toxinas Cry1Ab e Cry1F
CLNDO: Resistente à toxina Cry1F
Mead: Suscetíveis às toxinas Cry1Ab e Cry1F. Ferramenta para a caracterização de diferentes cepas bacterianas, através da visualização do peso molecular . Perfil Plasmidial Cepas cultivadas em LB a 30°C,
Centrifugações, ressuspensões (Reyes-Ramírez e Ibarra 2008). Resultados Antibióticos: 1547-2 e 2840-3: R rifampicina Eritromicina S a todos Estreptomicina apresentou variação de R: 3280-1, 3420-5 and 3420-12 Para as cepas atóxicas não há caracterização padronizada de antibióticos e concentrações, que determinam a susceptibilidade ou resistência Todas as cepas apresentaram mortalidade superior a 75% 1893-15 - 95% Correlação de subclasses - genes cry1F e 1Ab indica que a toxicidade pode ocorrer devido a interações sinérgicas entre as toxinas ou interação destes com os esporo Perfil Plasmidial 3 diferentes perfis 1547-1, 2840-3, 3420-5, 3280-1 - similar 3420-5 - banda única de 5000pb 1893-13 perfil distinto Presença ou ausência de bandas pode ser devido à presença de diferentes configurações do mesmo plasmídeo Metodologias + bioensaios proporciona uma alternativa adicional para a avaliação de novas estirpes de B. thuringiensis e para o conhecimento das diferenças intraespecíficas da espécie LEVELS OF MEMBRANE ALKALINE PHOSPHATASE AND AMINOPEPTIDASE TO LEPIDOPTERAN STRAINS RESISTANT TO CRY TOXINS FROM BACILLUS THURINGIENSIS Material e Métodos Insetos resistentes a Cry1Ab de O. nubilalis é originária de uma coleção de campos de larvas de Kandiyohi Co., MN.

Foi dividida em duas subpopulações,
um grupo foi mantido na ausência de toxinas Cry1Ab e Cry1F e o outro foi testado contra Cry1Ab e Cry1F em ensaios de diagnóstico. Insetos Revista: Oecologia Brasiliensis Capítulo 2 Publicado: Microorganisms in Industry and Environment. Capítulo 6 A atividade inseticida das proteínas de B. thuringiensis (toxinas Cry) estudadas em insetos. Introdução Toxinas ativadas são atraídas para a membrana intestino médio através de afinidade com gliproteínas: aminopeptidase N (APN), ou fosfatase alcalina (ALP) A especificidade das proteínas deve-se principalmente a sua interação com receptores. O principal objetivo do presente estudo foi identificar se a baixos níveis da expressão de ALP e ANP é um biomarcador potencial para resistência a toxinas Cry para a Broca do milho européia. Objetivos Os insetos foram criados em laboratório, utilizando dieta artificial de Gérmem de Trigo. SKY: R a toxina Cry1Ab
KS: R às toxinas Cry1Ab e Cry1F
CLNDO: R à toxina Cry1F
Mead: S às toxinas Cry1Ab e Cry1F Intestinos de larvas de 5 ínstar de cada linhagem foram dissecados (1g) e conduzidos à temperatura de gelo - submersos em tampão e congelado a -80°C. As concentrações de proteína a partir de preparações foram determinados pelo método de Bradford. BBMV foram preparados pelo método de centrifugação diferencial de Wolfersberger (1987). Quantificação da atividade: fosfatase alcalina (ALP) E aminopeptidase (APN) - leitor de microplacas (Biotek).
Os dados apresentados são as médias das atividades específicas de3 lotes independentes BBMV de cada linhagem. Western Blotting
- detectar proteínas em um homogenato SDS a 7,5% Resultados SKY - R toxinas Cry1Ab e Cry1F índices de ALP e APN, como já foi observado para outras espécies de pragas População R a Cry1F (CLNDO) níveis de tanto ANP e ALP. Média das atividades enzimáticas de ALP e APN CLNDO SKY Mead KS ALP CLNDO SKY CLNDO SKY Mead KS APN Caderina ALP M 1 2 3 4 M 1 2 3 4 75 kda 37kda 250kda 50kda Western blot foi realizada para confirmar as proteínas específicas da amostra Lane M, 1, 2, 3 and 4 represent Marker, BBMV from ECB midgut of KS (S to 1Ab and 1F), CLNDO (R to 1F), Mead (S to 1Ab and 1F) and Sky (R to 1Ab) respectively. Capítulo 2 Capítulo 3 Capítulo 4 Capítulo 5 Capítulo 6 PUBLICAÇÕES DA AUTORA Artigos completes publicados em periódicos ALLES, G. C.; HUBNER, M.; FIUZA, L.M. Toxiclogia de Bacillus thuringiensis às pragas urbanas e vetores. Biotecnologia Ciência & Desenvolvimento (Online), v. 38, p. 44-46, 2009.

AZAMBUJA, A.O.; ALLES, G.C.; FRITZ, L.L.; Reche, M.H.R.; FIUZA, L.M. Ecologia de Bacillus entomopatogênicos. Biotecnologia Ciência & Desenvolvimento (Online), v. 38, p. 14-23, 2009.

ALLES, G.C.; MACHADO, V.; FIUZA, L.M. Phenotypic characterization and the application of the rep-PCR technique in a study of new strains of Bacillus thuringiensis in the South of Brazil. In: Antonio Mendez-Vilas. (Org.). Microorganisms in Industry and Environment. From scientific and industrial research to consumer products. Microorganisms in Industry and Environment. From scientific and industrial research to consumer products. 2010, p. 96-100. Apresentação de trabalho em congressos CASSAL, M.C.; ALLES, G. C.; BERLITZ, D.L.; FIUZA, L.M. Seleção de novos isolados de Bacillus thuringiensis e Lysinibacillus sphaericus patogênicos a insetos-praga. In: CICPG Congresso de Iniciação Científica e Pós-Graduação, 2012, São Leopoldo. CICPG Congresso de Iniciação Científica e Pós-Graduação, 2012.

ALLES, G. C.; MACHADO, V. ; FIUZA, L. M. . Identificação molecular de novas cepas do entomopatógeno Bacillus thuringiensis, oriundas de amostras de solo do RS. 2009. XI Simpósio de Controle Biológico. ALLES, G.C.; OLIVEIRA, J.V.; FIUZA, L.M. Efeito de Produtos Fitossanitários e Antimicrobianos às Bactérias Entomopatogênicas Presentes em Solos Orizícolas. VI Congresso naciona de Arroz Irrigado, 2009, Porto Alegre.- Resumos publicados em anais de congressos.

ALLES, G.C.; CASSAL, M.C.; MACHADO, V.; FIUZA, L. M. Caracterização de Novas Cepas de Bactérias do Gênero Bacillus frente a Spodoptera frugiperda pertencentes ao Banco de Bactérias Entomopatogênicas da Unisinos.. In: Simpósio Latino Americano de Coleções Biológicas e Biodiversidade- Conhecimento e Gestao, 2012, Teresópolis. Simpósio Latino Americano de Coleções Biológicas e Biodiversidade- Conhecimento e Gestao, 2012.

CASSAL, M.C.; ALLES, G.C.; BERLITZ, D.L.; FIUZA, L.M. Insecticidal potential of new Bacillus thuringiensis and Lysinibacillus sphaericus strains against Spodoptera frugiperda (Lep. Noctuidae). In: 45th Annual Meeting of the Society for Invertebrate Pathology, 2012, Buenos Aires. 45th Annual Meeting of the Society for Invertebrate Pathology, 2012.

ALLES, G.C.; FIUZA, L.M. Patogenecidade de Bacillus thuringiensis contra spodoptera frugiperda (Lepidoptera, noctuidae) em laboratório. In: XXIII Congresso Brasileiro de Entomologia, 2010, Natal/RN. Anais do XXIII Congresso Brasileiro de Entomologia, 2010.

ALLES, G. C. ; MACHADO, V.; FIUZA, L. M. . Análise molecular e atividade tóxica de cepas de Bacillus thuringiensis. In: Congresso Brasileiro de Entomologia, 2010, Natal/RN. Anais do XXIII Congresso Brasileiro de Entomologia, 2010.

ALLES, G. C.; MACHADO, V.; FIUZA, L.M. Caracterização Fenotípica de Cepas do Entomopatógeno Bacillus thuringiensis Oriundas das Regiões Orizícolas do Rio Grande do Sul. In: VI Congresso Nacional de Arroz Irrigado, 2009, Porto Alegre. Estresses e sustentabilidade: desafios para a lavoura arrozeira. Santa Maria: Pallotti, 2009. p. 52-52. ALLES, G.C.; MACHADO, V.; FIUZA, L.M. 2009. RAPD-PCR caracterização fenotípica de novas cepas de Bacillus thuringiensis. XXV CBM, Porto de Galinhas, PE.

ALLES, G.C. & FIUZA, L.M. 2009. Novas cepas de Bacillus thuringiensis com atividade inseticida À Spodoptera frugiperda (LEPIDOPTERA, NOCTUIDAE). XXV CBM, Porto de Galinhas, PE.

ALLES, G.C.; MACHADO, V.; FIUZA, L. M. Caracterização de Estirpes de Bacillus Sphaericus Isoladas de Agroecossistemas Orizícolas. In: XI Simpósio de Controle Biológico, 2009, Bento Gonçalves. Anais do XI Siconbiol - CD do evento, 2009.

ALLES, G. C.; ALVES, C.M.; PANIZZON, J.; FIUZA, L.M. Interações de diferentes métodos de controle de Spodoptera frugiperda (Lepidoptera:Noctuidae) em laboratório. In: XI Simpósio de Controle Biológico, 2009, Bento Gonçalves. Anais Do XI Siconbiol - CD do evento, 2009. Bioensaios demosntraram o potencial patogênico da estirpe 3420-11
De acordo com Lee et ai. (1996), Schnepf et al. (1998), subclasses correlações genéticas de genes Cry com bioensaios indicam que a toxicidade de algumas estirpes aos insetos alvo podem ocorrer devido a interações sinérgicas entre as toxinas, ou pela interação com os esporos. Relatórios anteriores sugeriram que a interação direta entre toxinas cry de B. thuringiensis reduz a atividade de ALP em Manduca sexta. Apesar de não haver correlação entre os níveis de atividade de ALP e resistência a insecticidas, têm sido relatado na literatura que os baixos níveis podem ocorrer após intoxicação com lectinas (Kaur et al., 2009), a infecção com o vírus da poliedrose citoplasmática (CPV) ou B. thuringiensis em B. mori (Miao 2002). 1 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 36 37 38 40 41 42 44 43 44 45 46 47 48 49 50 51 52 53 Considerações finais 54 Considerações finais 55 56 57 Periódico: Journal of Applied Entomology - Nos estudos do Cap 3 (caracterização fenotípica e rep-PCR as 26 cepas testadas apresentaram uma resposta semelhante as regiões de origem, conferindo um grau de clonabilidade. - Nos ensaios de screening com S. frugiperda o isolado 3420-11 apresentou MC superior a 85%, e o gene cry1C foi mais frequente que o cry1F.
- Para O. nubilalis a cepa 1893-15 foi a mais promissora nos ensaios de toxicidade - Os níveis de atividade enzimática de ALP e APN se mostrou reduzida para as populações de O. nubilalis, mostrando relação com a resistência. Introdução
Full transcript