Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

From

No description
by

on 7 April 2014

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of From

Cell Biology - analysis of the coding sequences
1. Find the longest nucleotide sequence of the human MST1 gene transcript.

2. Compare the amino acid sequence of the translation product of the gene MST1 with homologous protein sequence in Drosophila melanogaster, showing schematically obtained results and giving the percentage of homology between two proteins.

3. Using databases, state MST1 protein function and diseases that are associated with mutations in the gene encoding MST1.

4. Using available publications find how to examine the role of human protein MST1 in the development of the disease on the D. melanogaster model.
1.
STK4/MST1 full gen lenght 6342 bp

CDS 1464 nt:

ATGGAGACGGTACAGCTGAGGAACCCGCCGCGCCGGCAGCTGAAAAAGTTGGATGAAGATAGTTTAACCA
AACAACCAGAAGAAGTATTTGATGTCTTAGAGAAACTTGGAGAAGGGTCCTATGGCAGCGTATACAAAGC
TATTCATAAAGAGACCGGCCAGATTGTTGCTATTAAGCAAGTTCCTGTGGAATCAGACCTCCAGGAGATA
ATCAAAGAAATCTCTATAATGCAGCAATGTGACAGCCCTCATGTAGTCAAATATTATGGCAGTTATTTTA
AGAACACAGACTTATGGATCGTTATGGAGTACTGTGGGGCTGGTTCTGTATCTGATATCATTCGATTACG
AAATAAAACGTTAACAGAAGATGAAATAGCTACAATATTACAATCAACTCTTAAGGGACTTGAATACCTT
CATTTTATGAGAAAAATACACCGAGATATCAAGGCAGGAAATATTTTGCTAAATACAGAAGGACATGCAA
AACTTGCAGATTTTGGGGTAGCAGGTCAACTTACAGATACCATGGCCAAGCGGAATACAGTGATAGGAAC
ACCATTTTGGATGGCTCCAGAAGTGATTCAGGAAATTGGATACAACTGTGTAGCAGACATCTGGTCCCTG
GGAATAACTGCCATAGAAATGGCTGAAGGAAAGCCCCCTTATGCTGATATCCATCCAATGAGGGCAATCT
TCATGATTCCTACAAATCCTCCTCCCACATTCCGAAAACCAGAGCTATGGTCAGATAACTTTACAGATTT
TGTGAAACAGTGTCTTGTAAAGAGCCCTGAGCAGAGGGCCACAGCCACTCAGCTCCTGCAGCACCCATTT
GTCAGGAGTGCCAAAGGAGTGTCAATACTGCGAGACTTAATTAATGAAGCCATGGATGTGAAACTGAAAC
GCCAGGAATCCCAGCAGCGGGAAGTGGACCAGGACGATGAAGAAAACTCAGAAGAGGATGAAATGGATTC
TGGCACGATGGTTCGAGCAGTGGGTGATGAGATGGGCACTGTCCGAGTAGCCAGCACCATGACTGATGGA
GCCAATACTATGATTGAGCACGATGACACGTTGCCATCACAACTGGGCACCATGGTGATCAATGCAGAGG
ATGAGGAAGAGGAAGGAACTATGAAAAGAAGGGATGAGACCATGCAGCCTGCGAAACCATCCTTTCTTGA
ATATTTTGAACAAAAAGAAAAGGAAAACCAGATCAACAGCTTTGGCAAGAGTGTACCTGGTCCACTGAAA
AATTCTTCAGATTGGAAAATACCACAGGATGGAGACTACGAGTTTCTTAAGAGTTGGACAGTGGAGGACC
TTCAGAAGAGGCTCTTGGCCCTGGACCCCATGATGGAGCAGGAGATTGAAGAGATCCGGCAGAAGTACCA
GTCCAAGCGGCAGCCCATCCTGGATGCCATAGAGGCTAAGAAGAGACGGCAACAAAACTTCTGA
http://www.uniprot.org/uniprot/Q13043
https://www.ncbi.nlm.nih.gov/nuccore/NM_006282.2
http://www.ensembl.org/Homo_sapiens/Gene/Summary?db=core;g=ENSG00000101109;r=20:43595115-43708600
with STK3, are activated in mitosis and catalyze the mitotic phosphorylation of MOBKL1A/MOBKL1B
Curr Biol. 2008 Mar 11;18(5):311-21. doi: 10.1016/j.cub.2008.02.006.MOBKL1A/MOBKL1B phosphorylation by MST1 and MST2 inhibits cell proliferation.Praskova M1, Xia F, Avruch J.

is activated in response to a variety of apoptotic stimuli and causes apoptosis when over-expressed in mammalian cells
Int J Mol Med. 2009 Mar;23(3):357-62.
The human WW45 protein enhances MST1-mediated apoptosis in vivo.
Luo X1, Li Z, Yan Q, Li X, Tao D, Wang J, Leng Y, Gardner K, Judge SI, Li QQ, Hu J, Gong J.

induces apoptotic chromatin condensation
J Biol Chem. 2010 Dec 10;285(50):39108-16. doi: 10.1074/jbc.M110.151753. Epub 2010 Oct 4.
MST1 promotes apoptosis through phosphorylation of histone H2AX.
Wen W1, Zhu F, Zhang J, Keum YS, Zykova T, Yao K, Peng C, Zheng D, Cho YY, Ma WY, Bode AM, Dong Z.



phosphorylates FOXO transcription factors in the cytosol and histone H2B in the nucleus to promote cellular apoptosis
Biochemistry. 2008 Jun 24;47(25):6719-26. doi: 10.1021/bi800309m.
Biochemical analysis of MST1 kinase: elucidation of a C-terminal regulatory region.
Anand R1, Kim AY, Brent M, Marmorstein R.

plays crucial roles in lymphocyte trafficking
EMBO J. 2009 May 6;28(9):1319-31. doi: 10.1038/emboj.2009.82. Epub 2009 Apr 2.
Mst1 controls lymphocyte trafficking and interstitial motility within lymph nodes.
Katagiri K1, Katakai T, Ebisuno Y, Ueda Y, Okada T, Kinashi T.




STK4/MST1 (mammalian sterile 20-like kinase 1) is the human ortholog of Drosophila Hippo, the central constituent of a highly conserved pathway controlling cell growth and apoptosis.
STK4/MST1 is a ubiquitously expressed serine/threonine pro-apoptotic kinase.
function
diseases associated with mutation in STK4/MST1 gene

playing an important role in prostate cancer progression
EMBO J. 2007 Oct 31;26(21):4523-34. Epub 2007 Oct 11.
The pro-apoptotic kinase Mst1 and its caspase cleavage products are direct inhibitors of Akt1.
Cinar B1, Fang PK, Lutchman M, Di Vizio D, Adam RM, Pavlova N, Rubin MA, Yelick PC, Freeman MR.

its activation in the heart causes cardiomyocyte apoptosis and dilated cardiomyopathy.
Biochem J. 2009 Feb 15;418(1):93-101.
Phosphorylation of cardiac troponin I by mammalian sterile 20-like kinase 1.
You B1, Yan G, Zhang Z, Yan L, Li J, Ge Q, Jin JP, Sun J.

STK4-deficient lymphocytes and neutrophils (premature termination mutation in the gene STK4) exhibit enhanced loss of mitochondrial membrane potential and increased susceptibility to apoptosis.
Blood. 2012 Apr 12;119(15):3450-7. Epub 2012 Jan 31.
The phenotype of human STK4 deficiency.
Abdollahpour H1, Appaswamy G, Kotlarz D, Diestelhorst J, Beier R, Schäffer AA, Gertz EM, Schambach A, Kreipe HH, Pfeifer D, Engelhardt KR, Rezaei N, Grimbacher B, Lohrmann S, Sherkat R, Klein C.

MST1 deficiency is associated with progressive loss of naive T cells. Consequences include recurrent bacterial and viral infections and autoimmune manifestations.
Blood. 2012 Apr 12;119(15):3458-68. doi: 10.1182/blood-2011-09-378364. Epub 2011 Dec 14.
MST1 mutations in autosomal recessive primary immunodeficiency characterized by defective naive T-cell survival.
Nehme NT1, Pachlopnik Schmid J, Debeurme F, André-Schmutz I, Lim A, Nitschke P, Rieux-Laucat F, Lutz P, Picard C, Mahlaoui N, Fischer A, de Saint Basile G.
Full transcript