Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

VECTORES DE CLONACION Y EXPRESION.

No description
by

JORGE CALZADA

on 7 March 2014

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of VECTORES DE CLONACION Y EXPRESION.

VECTORES DE CLONACION Y EXPRESION
Vector de clonación y expresión. Un vector de clonación contiene elementos como el origen de replicación, un sitio múltiple de clonación (SMC), que es una secuencia específica reconocida por diversas enzimas de restricción para poder insertar el ADNc del gen de interés y un marcador de selección. Un vector de expresión se utiliza para producir una proteína recombinante y contiene, además de los elementos mencionados, un promotor y un sitio IRES (sitio de entrada interna al ribosoma), así como
una secuencia de poliadenilación.
10,000 pb
500 copias por célula
pBR322
invitrogen
1 AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAA
51 TGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAA
101 CGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACT
151 TTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTT
201 CACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGGTACCGAGCT
251 CGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTAAGGGC
301 GAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAG
351 AGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCG
401 TTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGC
451 CTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCG
501 CACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGC
551 GCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCG
601 TGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTC
651 CCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCG
701 GGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCA
751 AAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAG
801 ACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACT
851 CTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTG
901 ATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTG
951 ATTTAACAAAAATTTAACGCGAATTTTAACAAAATTCAGGGCGCAAGGGC
1001 TGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTG
1051 ACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAA
1101 GCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTA
1151 GACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGC
1201 GCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCT
1251 TGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACA
1301 GGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTC
1351 TCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGA
1401 CAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGC
1451 CCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCA
1501 GGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCG
1551 CAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTG
1601 GGCGAAGTGCCGGGGCAGGATCTCCTGTCATCCCACCTTGCTCCTGCCGA
1651 GAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATC
1701 CGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCA
1751 CGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGA
1801 GCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCA
1851 TGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCG
1901 AATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCG
1951 GCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATA
2001 TTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTAC
2051 GGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGA
2101 CGAGTTCTTCTGAATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCG
2151 TGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTC
2201 ACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCA
2251 CGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAG
2301 TTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGC
2351 TATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGT
2401 CGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCAC
2451 AGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTG
2501 CCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATC
2551 GGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGT
2601 AACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACG
2651 ACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAA
2701 CTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGA
2751 CTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTC
2801 CGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCT
2851 CGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGT
2901 AGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGAC
2951 AGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGAC
3001 CAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATT
3051 TAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCC
3101 CTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATC
3151 AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCA
3201 AACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGC
3251 TACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCA
3301 AATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTC
3351 TGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTG
3401 CTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG
3451 TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACA
3501 GCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTG
3551 AGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTAT
3601 CCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGG
3651 GGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGAC
3701 TTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA
3751 AACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTT
3801 TGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTA
3851 TTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAG
3901 CGCAGCGAGTCAGTGAGCGAGGAAGCGGAAG
Full transcript