Loading presentation...

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in our knowledge base article

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

Using the Galaxy platform for RNA-Seq data analysis

Short course given during the X-Meeting 2012, 2012/10/15
by

Felipe Rodrigues da Silva

on 31 January 2013

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of Using the Galaxy platform for RNA-Seq data analysis

Transcritos EST – Expressed Sequence Tag DNA RNA proteína Dogma Central da Biologia clonar sequenciar Galaxy: uma ferramenta para aproximar biólogos de verdade da bioinformática de verdade! Felipe Rodrigues da Silva Lab. de Bioinformática Aplicada - LBA
Embrapa Informática Agropecuária felipes@cnptia.embrapa.br Sequenciamento de
Próxima Geração - NGS X Unidades de serviço

Unidades de pesquisa de produtos

Unidades de pesquisa de temas básicos

Unidades de pesquisa agroflorestal ou agropecuária nas ecorregiões brasileiras Embrapa No século passado! Biologia na Unicamp 1989 Embrapa Algodão
Embrapa Arroz e Feijão
Embrapa Caprinos e Ovinos
Embrapa Florestas
Embrapa Gado de Corte
Embrapa Gado de Leite
Embrapa Hortaliças Embrapa Milho e Sorgo
Embrapa Pesca, Aquicultura
Embrapa Soja
Embrapa Suínos e Aves
Embrapa Trigo
Embrapa Uva e Vinho
Embrapa Mandioca e Fruticultura Embrapa Agrobiologia
Embrapa Agroenergia
Embrapa Agroindústria de Alimentos
Embrapa Agroindústria Tropical
Embrapa Estudos e Capacitação
Embrapa Informática Agropecuária Embrapa Instrumentação
Embrapa Meio Ambiente
Embrapa Monitoramento por Satélite
Embrapa Recursos Genéticos e Biotecnologia
Embrapa Solos Embrapa Mato Grosso
Embrapa Meio-Norte
Embrapa Pantanal
Embrapa Rondônia
Embrapa Roraima
Embrapa Semiárido
Embrapa Tabuleiros Costeiros Embrapa Acre
Embrapa Agropecuária Oeste
Embrapa Amapá
Embrapa Amazônia Ocidental
Embrapa Amazônia Oriental
Embrapa Cerrados
Embrapa Clima Temperado Embrapa Café
Embrapa Gestão Territorial
Embrapa Informação Tecnológica
Embrapa Produtos e Mercado
Embrapa Quarentena Vegetal 5 14 17 11 informática Como eu fui parar lá? 1983 - Tia Nini 1991 - AAoW 1992 - Bacherelado 1996 - Mestrado 1997 - Grupo Genoma CBMEG 2001 - Doutorado 2009 - Posdoc - IC 1992 - 386 Colorido! 9.660
empregados 2.392
pesquisadores
(24.8%) 74% - doutores
7% - posdocs Orçamento 2012
R$ 2,1 bilhões. + (bio) = http://www.embrapa.br/a_embrapa/missao_e_atuacao Adhemar Zerlotini Neto Francisco Pereira Lobo Formato fastQ @HS2_07083:2:1206:14255:166166#2
TGAGTAGATAAAATTTGACAACAATCTAAAGGCATTATTAAGTAATCAGAATCATTTTCAGTAGAACCAATCCCT
+
<BEHEID>JFJKKKLGKNJIJKJEHKELKMLFKLIIIMLLMHGJLIFFFILJCGLLCMIHJDLEKJH9E:LJH8B
@HS2_07083:2:1206:14255:166166#2
TCCAGGGTGGACAATAAGACCTTGTAGGCTGCAAGAGCCTGCCTCTGTCATTCTGGCCACAAAATCTGAGAAGGA
+
1LJIDNJ5MGL3KKDJFC+KHMHGIDKBG?BKCJ@96IFKBJIHGICIEGIEJJKJHILCJGKKIKHIFGFFED9
@HS2_07083:2:1207:20616:121747#2
CAAAATTCCAACTCAATTCTTCAACGAATTGGAAGGAGCAATTTGCAAATTTGTCTGGAATAACAAAAAACCTAG
+
7DEDEGFIKKHKIHJJLLGJHJKKKIJIKGKLIJLKJHMHLEMKJIJFGKKLDMKMIKKGDDIJLJMMMNJIJLJ >HS2_07083:2:1206:14255:166166#2
TGAGTAGATAAAATTTGACAACAATCTAAAGGCATTATTAAGTAATCAGAATCATTTTCAGTAGAACCAATCCCT
>HS2_07083:2:1206:14255:166166#2
TCCAGGGTGGACAATAAGACCTTGTAGGCTGCAAGAGCCTGCCTCTGTCATTCTGGCCACAAAATCTGAGAAGGA
>HS2_07083:2:1207:20616:121747#2
CAAAATTCCAACTCAATTCTTCAACGAATTGGAAGGAGCAATTTGCAAATTTGTCTGGAATAACAAAAAACCTAG Formato fasta >HS2_07083:2:1206:14255:166166#2
9 9 9 6 6 6 4 6 4 4 4 4 4 7 9 8 8 7 4 4 9 9 7 7 4 0
4 19 20 27 32 29 20 15 4 0 4 7 7 9 19 23 24 18 10 10
6 9 15 17 31 28 27 13 12 8 8 9 12 19 31 48 44 46 46
46 46 46 35 35 35 35 35 35 46 46
>HS2_07083:2:1206:14255:166166#2
6 6 4 4 4 4 6 6 6 6 6 7 7 7 8 8 22 15 15 4 4 4 9 16
17 27 18 18 15 20 12 14 18 27 32 32 32 29 29 29 29
29 29 29 29 29 29 42 42 33 32 32 40 40 37 40 37 35
35 35
>HS2_07083:2:1207:20616:121747#2
4 4 4 6 4 7 7 7 7 10 10 8 4 0 4 8 8 13 23 19 12 9 8
19 13 15 14 20 19 28 21 16 16 23 29 40 40 56 56 56
51 51 46 46 46 46 51 51 51 51 51 56 51 51 51 39 39
39 39 39 39 40 40 46 46 51 51 51 40 40 40 39 35 35
35 39 arquivo .qual Galaxy Exercício com RNAseq http://www.cnptia.embrapa.br/~felipes/Galaxy/ ferramentas dados história Dados
processados cinza: na fila amarelo:
processando verde: pronto no LMB RNAseq, sem saber programar sem saber *nix várias ferramentas na mesma interface mesmo depois que se apagam os dados pode salvar a sequência de passos (workflow) , etc. NGS: QC and manipulation
FASTQ Groomer NGS: RNA Analysis
Tophat for Illumina cuffcompare guarda todos os passos (e parâmetros) das análise Francisco Lobo Caminho... felipe.silva@embrapa.br
Full transcript