Prezi

Present Remotely

Send the link below via email or IM

Copy

Present to your audience

Start remote presentation

  • Invited audience members will follow you as you navigate and present
  • People invited to a presentation do not need a Prezi account
  • This link expires 10 minutes after you close the presentation
  • A maximum of 30 users can follow your presentation
  • Learn more about this feature in the manual

Do you really want to delete this prezi?

Neither you, nor the coeditors you shared it with will be able to recover it again.

DeleteCancel

Make your likes visible on Facebook?

Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.

No, thanks

fitosanidad.

seminario 1
by rodolfo aldana perez on 25 October 2013

Comments (0)

Please log in to add your comment.

Report abuse

Transcript of fitosanidad.

Seminario 1 Generalidades, marco teórico, metodología y aislamientos.
Noemi Gómez Ojeda y Rodolfo Aldana Pérez
Tesis en B.T.
Asesores: D.C Eduardo Molina Gayosso y M.C Gabriela Alvarado Castillo

Taxonomía Leonian (1922)
Problemática.
Reseña histórica de Phytophthora y razón de estudio
Bary 1876 con P. infestans.
Cook y horne cuba 1908 en citricos.


Morfologia.
AISLAMIENTO, IDENTIFICACIÓN Y CARACTERIZACIÓN MOLECULAR DE HONGOS ANTAGONISTAS COMO ALTERNATIVA DE BIOCONTROL CONTRA PATÓGENOS
celulas totiponciales
Enfermedades causadas:
Reproducción
Actualmente la presencia de fitopatogenos en los cultivos a sido motivo de grandes perdidas económicas y peor aun a sido una de las causas que ha contribuido en el desequilibrio ambiental a consecuencia de la invasión de espacios a nivel mundial.
Division: Eumycota.
Subdivision: Phymycotina.
Clase: Omycetes.
Orden: Peronosporales.
Subfamilia: Phythiae.
Genero: phythophthora.
Micelio: hileano continuo de paredes paralelas donde se observan abundantes gotas oleaginosas. El micelio es cenotico.
Presenta dos tipos de reproducción.

Asexual: Con la formación de clamidosporas y esporangios que contienen las zoosporas.

Sexual: mediante la formación de oosporas.

Metodología
Imagen tomada de http://commons.wikimedia.org/wiki/File:Phytophthora_life_cycle.png

Aspecto macroscópico y microscópico del patógeno Phytophthora capsici. [A]: P. capsici creciendo en medio líquido con formación de colonias esféricas que liberan zoosporas. [B]: Aspecto macroscópico de la colonia miceliana creciendo en medio sólido de patata-dextrosa-agar (PDA). [C]: Detalle de un esporangio productor de zoosporas visto al microscopio electrónico de barrido (2300 X)
http://www.horticom.com/pd/print.php?sid=62425
PC-1 GTCTTGTACCCTATCATGGCG
PC-2 CGCCACAGCAGGAAAAGCATT
Complementaria: GCGGTGTCGTCCTTTTCGTAA

Tamaño: EC-1: 21, EC-2:21.
Porcentaje EC-1 G:23.8%, T:33.3%, C:28.57%, A:14.28%
EC-2 G:23.8%, T:9.52%, C:28.57%, A:38.09%

TM: Tm = 2(A+T) + 4(G+C) Fórmula de Wallace
EC-1: Tm=2(3+7)+4(5+6)=64ºC
EC-2: Tm=2(8+2)+4(5+6)=64ºC

Oligos propuestos por Zapata-Vázquez, A., et al 2012.
Justificación
Dado lo anterior, se han propuesto diferentes técnicas reduccionistas que controlen los efectos causados por especies de los géneros Pityum, Fusarium y Phytophthora. Por otra parte mediante la aplicación de la ingeniería Genética se han propuesto especies resistentes, sin embargo dado que el comportamiento in vivo esta en constante cambio, las técnicas anteriores no suelen ser las mas eficientes; por lo que se propone un consorcio de Antagonistas como control biológico.
Se tomaron especies criollas con una sintomatología critica causada por patógenos presentes en la raíz de Chile Miahuateco, ubicadas en la comunidad de Tehuacan Puebla
Muestreo
Se realizaron aislamientos de microorganismos endofitos y de superficie del chile Miahuateco, utilizando segmentos aleatorios de la raíz; los cuales se cultivaron en medio PDA bajo en Carbohidratos adicionado con antibióticos (Ampicilina-Cloranfenicol).
Aislamiento
Se tomarán segmentos de los aislamientos obtenidos con la ayuda de un sacabocados y se colocarán bajo condiciones de esterilidad en tubos Eppendorf de 2 mL c/u que contengan agua inyectable.
Conservación
Caracterización molecular
Prueba de antagonismo
Prueba de germinación
Se sembrarán 10 semillas de chile comercial en cajas P100, las cuales contendrán una mezcla de suelo y peat moss esteril.
Específicos:
Obtener aislamientos puros (endofitos y de superficie) presentes en la raíz del chile miahuateco.
Realizar pruebas de germinación y antagonismo .
Caracterizar molecularmente los microorganismos obtenidos.
General:
Evaluar el efecto Antagónico del consorcio biológico presente en la raíz de especies del genero Capsicum contra sus Patógenos.
OBJETIVOS

La patología dependerá de la especie que se encuentre en el organismo, en el particular de Phytophthora:

en cítricos es causante de gomosis, del aguado podredumbre marron de los frutos, además de la podredumbre del cuello de la raíz y parte basal del tallo.
Resultados.
Se logro el aislamiento de 45 posibles cepas endofitas presentes en la raíz del genéro Capsicum mediante caracterización Morfotípica.
Endofitos
Microorganismos de superficie.
literatura consultada
Castro Rocha, A., Fernández Pavía, S. P., & Osuna Ávila, P. (2012). Mecanismos de Defensa del Chile en el Patosistema Capsicum annuum-Phytophthora capsici. Revista Méxicana de FITOPATOLOGÍA , 49-65.
Donald, C. E., & Olak, K. R. (1996). Phytophthora Diseases worldwide. Unated States of America: The American Pyitopatological Society.
Espinoza, L. (517-540). Guia practica sobre la técnica de PCR.
Larroque, M., Belmas, E., Martínez, T., Vergnes, S., Ladouce, N., Lafitte, C., y otros. (2013). Pathogen-associated molecular pattern-triggered immunity and resistance to the root pathogen Phytophthora parasitica in Arabidiopsis. Journal of experimeltal Botany .
Li, M., Inada, M., Watanabe, H., Suga, H., & Kageyama, K. (2013). Simultaneusdetection and quantification of Phytophthora nicotianae and P. cactorum, and distribution Analyses in Strawberry Greenhouses by Duplex Real-time PCR. Microbes Environ , 195-203.
Lozoya-Saldaña, H., Coyote-Palma, M. H., Ferrera-Cerrato, R., & Lara-Hernández, M. E. (2006). Antagonismo microbiano contra Phytophthora infestans (Mont) de Bary. Agrociencia , 491-499.
Luque, J., & Herráez, Á. (2002). Biología molecular e Ingeniería Genética. Madrid España: Elsevier.
Martínez Fernandéz, M. (2012). Evaluacion de tres cepas de Trichoderma spp., como alternativa de biocontrol contra Phytophthora capsici L. en plantulas de pimiento morrón bajo invernadero. Victoria de Durango, Dgo.: tesis, Instituto Politecnico Nacional y Centro interdisiplinario de investigacion para el desarrollo integral regional.
Molina Gayosso, E. (2010). Búsqueda de control Biológico de Phytophtora capsici en Chile Mediante alta diversidad Microbiana, considerando al patosistema como sistema adaptativo complejo. Montecillo, Texcoco, Estado de México: Tesis, Colegio de Postgraduados.
Morán-Bañuelos, S. H., Aguilar-Ricón, V. H., Corona-Torres, T., & Zavaleta-Mejía, E. (2010). Resistencia a Phytophthora capsici Leo. De chiles nativos del sur de Puebla México. Fitotec , 21-26.
Promega Corporation. (2009). Wizard SV Gel and PCR Clean-Up System. USA: Promega Technical Bulletin.
Santos Juárez, P. (2010). Estrategias para el control de Phytophthora capsici Leo. y Fusrium solani Mart. en el cultivo de Chile (Capsicum annuum L). Tesis, Posgrado de Fitosanidad Fitopatología (pág. 62). Montecillo, Texcoco, Edo. de México: Colegío de Postgraduados.
Universidad Nacional Autónoma de México. (2012). Protocolo de practicas microbiología experimental. México. DF.: departamento de Biología.
Ying-Le, Z., Qing-Le, J., Jun-E, W., Yan-Xu, Y., & Zhen-hui, G. (2013). Chartacteristic of the Pepper CaRGA2 Gene in Defense Responses against Phytophthora capsici Leonian. Molecular Sciences , 8985-9004.
Zapata-Vásquez, A., Sanchez-Sanchez, M., del-Río-Robledo, A., Silios-Espino, H., Perales-Segovia, C., Flores-Benites, s., y otros. (2012). Phytophthora capsici Epidemic Dispersion on Commercial Pepper Fields in Aguascalientes, México. The Scientific World JOURNAL , 5.


Muchas Gracias!!!
Resultados
Se logro la purificación de 30 cepas diferentes, las cuales se clasificaron tomando en cuenta las características morfotípicas.
See the full transcript